View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8839_low_14 (Length: 273)
Name: NF8839_low_14
Description: NF8839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8839_low_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 257
Target Start/End: Original strand, 43485041 - 43485285
Alignment:
| Q |
13 |
agaagcagagaatacgtggcttacttgagcagtgtacattagaccacgaggccagaatggaaaatttgcgtaacgagttgcatgaaaaggctctttctga |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43485041 |
agaatcagagaatacgtggcttacttgagcagtgtacattagaccacgaggccagaatggaaaatttgcgtaacgagttgcatgaaaaggctctttctga |
43485140 |
T |
 |
| Q |
113 |
tgccagatggaagcagattcaagaagaattgagcgaatctgtaggtgcaaaatggttttaagctatattgaaaaatgtttaannnnnnnnnnnnaatatc |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43485141 |
tgccagatggaagcagattcaagaagaattgagcgaatctgtaggtgcaaaatggttttaagctatattgaaaaatgtttaattttttctttttaatatc |
43485240 |
T |
 |
| Q |
213 |
ctttctataactattgtcagtcagatatcaacaactcctatcctg |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43485241 |
ctttctataactattgtcagtcagatatcaacaactcctatcctg |
43485285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University