View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8839_low_21 (Length: 239)
Name: NF8839_low_21
Description: NF8839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8839_low_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 16 - 224
Target Start/End: Complemental strand, 11999164 - 11998956
Alignment:
| Q |
16 |
gttatgtgacaaggactgactaacttggagaactttatgtaatgtcggggaccattttgaaatggcttgattgatgcaagtgtcaaaagcaaaggaccat |
115 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11999164 |
gttaagtgacaaggactgactaacttggagaactttatgcaatgtcggggaccattttgagatggcttgattgatgcaagtgtcaaaagcaaaggaccat |
11999065 |
T |
|
| Q |
116 |
tttgggtatttactcactcttaatgtaaattatttgcgaaattcaaacttgatcattgcaaaaatctaattaaaaaagtatacttatcttatgaaataac |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11999064 |
tttgggtatttactcacccttaatgtaaattatttgcgaaattcaaacttgatcattgcaaaaatctaattaaaaaagtatacttatcttatgaaataac |
11998965 |
T |
|
| Q |
216 |
tacataact |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
11998964 |
tacataact |
11998956 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University