View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8839_low_26 (Length: 220)
Name: NF8839_low_26
Description: NF8839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8839_low_26 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 220
Target Start/End: Complemental strand, 45981255 - 45981036
Alignment:
| Q |
1 |
aggtgaaacatagaccaaacttttgcacttgctaaggaaaccgctaatgtgcatgtttcagtccttgccatttgtgcatacacttatcaatagtctaagt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45981255 |
aggtgaaacatagaccaaacttttgcacttgctaaggaaaccgttaatgtgcatgtttcagtccttgccagttgtgcatacacttatcaatagtctaagt |
45981156 |
T |
|
| Q |
101 |
caagtctttgaataaatcttcttgcaatcagtacatgatgattaacttatcttgcatttgcagctttgcatacttannnnnnnagtacatgatgatttat |
200 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45981155 |
caagtctttgaagaaatcttcttgcaatcagcacatgatgattaacttatcttgcatttgcagctttgcatacttatatttttagtacatgatgatttat |
45981056 |
T |
|
| Q |
201 |
tggttaaagaaagtaaacca |
220 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
45981055 |
tggttaaagaaagtaaacca |
45981036 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 9 - 81
Target Start/End: Complemental strand, 45991912 - 45991840
Alignment:
| Q |
9 |
catagaccaaacttttgcacttgctaaggaaaccgctaatgtgcatgtttcagtccttgccatttgtgcatac |
81 |
Q |
| |
|
|||||||||| || ||||||||||||||||| || ||| ||||||||||||||||||||||| ||| |||| |
|
|
| T |
45991912 |
catagaccaacctcttgcacttgctaaggaacccactagcctgcatgtttcagtccttgccattggtgtatac |
45991840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University