View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_high_17 (Length: 244)
Name: NF8841_high_17
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_high_17 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 94 - 244
Target Start/End: Complemental strand, 38840767 - 38840617
Alignment:
| Q |
94 |
ggtatgtattgatgatcgggtgaattggttgtgttatgaaggttttctcaaacaatatggggacaaagtctgagccagtgataaccgaatgcaatgctag |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38840767 |
ggtatgtattgatgatcgggtgaattggttgtgttatgaaggttttctcaaacaatatggggacaaagtctgagccagtgataaccgaatgcaatgctag |
38840668 |
T |
 |
| Q |
194 |
tgagaactggacaaaggtaacctttaagcctgccttggaaaagttcaaaat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38840667 |
tgagaactggacaaaggtaacctttaagcctgacttggaaaagttcaaaat |
38840617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 122 - 244
Target Start/End: Complemental strand, 9875879 - 9875757
Alignment:
| Q |
122 |
ttgtgttatgaaggttttctcaaacaatatggggacaaagtctgagccagtgataaccgaatgcaatgctagtgagaactggacaaaggtaacctttaag |
221 |
Q |
| |
|
||||||||||||||| ||| || |||||||||||| |||||||| |||||||||||| |||| || |||| |||||||||||| ||||| ||||||||| |
|
|
| T |
9875879 |
ttgtgttatgaaggtgttcacagacaatatggggaagaagtctgatccagtgataaccaaatgtaaagctaatgagaactggaccaaggtgacctttaag |
9875780 |
T |
 |
| Q |
222 |
cctgccttggaaaagttcaaaat |
244 |
Q |
| |
|
|||| |||||| ||||| ||||| |
|
|
| T |
9875779 |
cctgacttggagaagtttaaaat |
9875757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University