View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_high_22 (Length: 221)
Name: NF8841_high_22
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_high_22 |
 |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0015 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 177904 - 178124
Alignment:
| Q |
1 |
gatgaagatgtgcctctacttatgggtaggaacttcatgcaaacagcccgaatgatgattgacctcgatgataacatcatgaaggtcaaagttgataatg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
177904 |
gatgaagatgtgcctctacttatgggtaggaacttcatgcaaattgcccgaatgatgattgacctcgatgataacatcatgaaggtcaaagttgataaag |
178003 |
T |
 |
| Q |
101 |
aagaggttactttcaacattcgtgaagccataaagcactcaaaagacaagttcggatgttttaaaatggatgcaaccgaagaagtcatcatgaccacccg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
178004 |
aagaggttactttcaacattcgtgaagccataaagcactcaaaagacaagttcggatgttttaaaatggatgcaaccgaagaagtcatcatgaccacccg |
178103 |
T |
 |
| Q |
201 |
gaagcaatttcataaacgaac |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
178104 |
gaagcaatttcataaacgaac |
178124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 20171525 - 20171740
Alignment:
| Q |
1 |
gatgaagatgtgcctctacttatgggtaggaacttcatgcaaacagcccgaatgatgattgacctcgatgataacatcatgaaggtcaa-agttgataat |
99 |
Q |
| |
|
||||| ||||| ||| ||||| |||| || ||||||||||||| || || ||||||||||||||||||||||| || ||||| || || ||||| |||| |
|
|
| T |
20171525 |
gatgatgatgtacctatacttttgggaagatacttcatgcaaacggcacggatgatgattgacctcgatgataatattatgaaagttaagagttgttaat |
20171624 |
T |
 |
| Q |
100 |
gaagaggttactttcaacattcgtgaagccataaagcactcaaaagacaagttcggatgttttaaaatggatgcaaccgaagaagtcatcatgaccaccc |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||| ||| | ||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
20171625 |
gaagaggtaactttcaacattcgtgaagccattaagcactcaaaagataagagtgtatgctttaaaatggatgcaaccgaagaagtcatcatgaccactc |
20171724 |
T |
 |
| Q |
200 |
ggaagcaatttcataa |
215 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
20171725 |
ggaagcaatttcataa |
20171740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University