View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_high_9 (Length: 315)
Name: NF8841_high_9
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_high_9 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 276; Significance: 1e-154; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 276; E-Value: 1e-154
Query Start/End: Original strand, 11 - 315
Target Start/End: Original strand, 4048211 - 4048519
Alignment:
| Q |
11 |
catcatctttcatcacactactaataatc----tgtcacgagcacagacaatagagtgcagctgctgctgctccacctgccggccgtcatttcacacttc |
106 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048211 |
catcatctttcatcacactactaataatcaatctgtcacgagcacagacaatagagtgcagctgctgctgctccacctgccggccgtcatttcacacttc |
4048310 |
T |
 |
| Q |
107 |
tgctctgccatcactcactgatttgacccttcttccacgtggtccctctcattctcagttttcacgcaattttatattatttaattgggggcggtacctt |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048311 |
tgctctgccatcactcactgatttgacccttcttccctgtggtccctctcattctcagttttcacgcaattttatattatttaattgggggcggtacctt |
4048410 |
T |
 |
| Q |
207 |
ggttatagtccaattttgtgggacccacttagggtagatgataacgtggcgtgtttctgatgagtagccccatcaccaaagaatctgtcggcagcagaga |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4048411 |
ggttatagtccaattttgtgggacccacttagggtagattataacgtggcgtgattctgatgagtagccccatcaccaaagaatctgtcggcagcagaga |
4048510 |
T |
 |
| Q |
307 |
cgtcacgct |
315 |
Q |
| |
|
||||||||| |
|
|
| T |
4048511 |
cgtcacgct |
4048519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University