View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_low_10 (Length: 406)
Name: NF8841_low_10
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_low_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 369; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 369; E-Value: 0
Query Start/End: Original strand, 20 - 404
Target Start/End: Complemental strand, 29941364 - 29940980
Alignment:
| Q |
20 |
catcccccacctccttcattgtagtttctgtatgcttcccaacagtaagttgcttttgagttgaagcttcaataagtgtcctctgctgttcgacttcttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29941364 |
catcccccacctccttcattgtagtttctgtatgcttcccaacagtaagttgcttttgagttgaagcttcaataagtgtcctctgctgttcgacttcttc |
29941265 |
T |
 |
| Q |
120 |
ctctctttccacttcagttccaaaattctgacctttgctattgctgtgtgagggaaagaggtttttactgcaggcactagaacttgattccttgctcggc |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29941264 |
ctctctttccacttcagttccagaattctgacctttgctattgctgtgtgagggaaagaggtttttactgcaggcactagaacttgattccttgctcggc |
29941165 |
T |
 |
| Q |
220 |
tcgtatgtaacttttgggagcggtgacgccctaagccaggggccataagcttggtctttctcctccagctcccggaaaccatcagcatcagggtctttac |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| || |
|
|
| T |
29941164 |
tcgtatgtaacttttgggagcggtgacgccctaagccaggggccataagcttggtctttctcctccagctcccggaaaccatcagcatccgggtcttcac |
29941065 |
T |
 |
| Q |
320 |
attcttcacaatcacgcatctgatgtcctatcctcccacaggcaaaacagaagttgggcaatcgttcatacttgtaatcaaccca |
404 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29941064 |
attcttcacaatcacgcatctgatgtcctatcctcccacatgcaaaacagaagttgggcaatcgttcatacttgtaatcaaccca |
29940980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000006; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 322 - 404
Target Start/End: Complemental strand, 36810460 - 36810378
Alignment:
| Q |
322 |
tcttcacaatcacgcatctgatgtcctatcctcccacaggcaaaacagaagttgggcaatcgttcatacttgtaatcaaccca |
404 |
Q |
| |
|
||||||||||| | ||| ||||| ||||| ||||||||| |||||||| || ||||| ||||||||||||||||||||||| |
|
|
| T |
36810460 |
tcttcacaatccctcatttgatgccctattctcccacagatgaaacagaaatttggcaaacgttcatacttgtaatcaaccca |
36810378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University