View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_low_16 (Length: 318)
Name: NF8841_low_16
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_low_16 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 20 - 291
Target Start/End: Original strand, 45654147 - 45654418
Alignment:
| Q |
20 |
catctttgtagtaattgtaaaaagtctccaaaagaggagccattatatcccaaaaaccacaccaaatatgattttcagtaggtaaacagattagaaaatt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45654147 |
catctttgtagtaattgtaaaaagtctccaaaagaggagccattatatcccaaaaaccacaccaaatatgattttcagtaggtaaacagattataaaatt |
45654246 |
T |
|
| Q |
120 |
atatgcatctgcaaacctaacagtaattaaaacgattttcattaattaaattggattaagacataatagtaatatgtgaaagagggaaggaacgaaccat |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654247 |
atatgcatctgcaaacctaacagtaattaaaacgattttcattaattaaattggattaagacataatagtaatatgtgaaagagggaaggaacgaaccat |
45654346 |
T |
|
| Q |
220 |
tgctctttgtggaggtggatgcgacgatgtttagagggatcaagatcaacaacatcgacatcgtcatcggcg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654347 |
tgctctttgtggaggtggatgcgacgatgtttagagggatcaagatcaacaacatcgacatcgtcatcggcg |
45654418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University