View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_low_18 (Length: 309)
Name: NF8841_low_18
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 266
Target Start/End: Original strand, 179483 - 179748
Alignment:
| Q |
1 |
tctcctttcaattaatctcatcactaccatcagctcaaagttccatattcatgcggtcctaatccaagatatcaaagacaagctttctctaaggaatttt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
179483 |
tctcctttcaattaatctcatcactaccaccagttcaaagttccatattcatgcggccctaatccaagatatcagagacaagctttctctaaggaatttt |
179582 |
T |
 |
| Q |
101 |
tcgctccaccacaccctccgtgaaggaaatcaaagtgctgaccatttggctaagctaggtgcaatttcagatgtcaacattcttatacaccagtcgtctc |
200 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||||||| |||||||||| ||||||||||| |||||||||||| |||| |||||||||||| ||| |
|
|
| T |
179583 |
tcgctcaaccacaccctccgggaaggaaatcaaagtgctgactatttggctaaactaggtgcaatgtcagatgtcaacgttctaatacaccagtcgcctc |
179682 |
T |
 |
| Q |
201 |
ccgatgaactctgcccttttttgaagaatgatgcagcaggaaccatgttcctgagatcttagtttc |
266 |
Q |
| |
|
| ||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
179683 |
cggatgaactctgccctttgttgaagaatgatgcagcaggaaccttgttcctgagatcttagtttc |
179748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University