View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8841_low_2 (Length: 528)

Name: NF8841_low_2
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8841_low_2
NF8841_low_2
[»] chr2 (83 HSPs)
chr2 (200-521)||(19456701-19457022)
chr2 (200-521)||(21703444-21703765)
chr2 (219-509)||(27434746-27435036)
chr2 (10-160)||(19456511-19456661)
chr2 (200-521)||(27392630-27392951)
chr2 (219-520)||(23128868-23129169)
chr2 (219-520)||(28881852-28882153)
chr2 (10-160)||(21703254-21703404)
chr2 (219-520)||(20837556-20837857)
chr2 (219-520)||(12655180-12655481)
chr2 (10-160)||(34303393-34303543)
chr2 (10-157)||(27392973-27393120)
chr2 (10-160)||(3784655-3784805)
chr2 (10-160)||(16163600-16163750)
chr2 (10-160)||(34157012-34157162)
chr2 (10-160)||(27118689-27118839)
chr2 (38-160)||(31891446-31891568)
chr2 (200-334)||(31891608-31891742)
chr2 (200-334)||(27118515-27118649)
chr2 (210-334)||(3784481-3784605)
chr2 (210-334)||(34156838-34156962)
chr2 (219-334)||(34303602-34303717)
chr2 (210-334)||(16163426-16163550)
chr2 (222-520)||(34279087-34279385)
chr2 (222-469)||(13936849-13937096)
chr2 (222-436)||(21677487-21677701)
chr2 (336-520)||(37374799-37374983)
chr2 (222-469)||(261070-261317)
chr2 (222-520)||(11635494-11635792)
chr2 (222-520)||(11641683-11641981)
chr2 (38-160)||(28882215-28882337)
chr2 (222-469)||(34286043-34286290)
chr2 (222-469)||(34291103-34291350)
chr2 (38-160)||(12655543-12655665)
chr2 (255-437)||(12716943-12717125)
chr2 (38-160)||(23128684-23128806)
chr2 (10-160)||(27434534-27434684)
chr2 (17-160)||(11635283-11635426)
chr2 (222-469)||(37925182-37925429)
chr2 (38-160)||(20837919-20838041)
chr2 (38-160)||(21677300-21677422)
chr2 (17-160)||(11641472-11641615)
chr2 (330-469)||(12586490-12586629)
chr2 (17-160)||(22926125-22926268)
chr2 (330-437)||(31876002-31876109)
chr2 (17-160)||(34279450-34279593)
chr2 (330-437)||(34861401-34861508)
chr2 (330-437)||(37686322-37686429)
chr2 (330-437)||(37701587-37701694)
chr2 (330-437)||(39889783-39889890)
chr2 (222-469)||(40233188-40233435)
chr2 (10-157)||(40233515-40233662)
chr2 (222-430)||(32049526-32049734)
chr2 (330-469)||(9350407-9350546)
chr2 (342-437)||(16829763-16829858)
chr2 (342-437)||(16891623-16891718)
chr2 (330-469)||(27776896-27777035)
chr2 (330-469)||(27803381-27803520)
chr2 (330-469)||(27816663-27816802)
chr2 (17-160)||(34286355-34286498)
chr2 (17-160)||(34291415-34291558)
chr2 (330-460)||(19416912-19417042)
chr2 (330-436)||(22926441-22926547)
chr2 (38-160)||(34861681-34861803)
chr2 (38-160)||(37686027-37686149)
chr2 (38-160)||(37701292-37701414)
chr2 (38-160)||(37925494-37925616)
chr2 (38-160)||(31876282-31876404)
chr2 (17-159)||(37375163-37375305)
chr2 (60-157)||(13936684-13936781)
chr2 (216-469)||(39052127-39052380)
chr2 (38-160)||(16829456-16829578)
chr2 (38-160)||(16891903-16892025)
chr2 (38-160)||(32049799-32049921)
chr2 (38-160)||(39890075-39890197)
chr2 (60-157)||(12716742-12716839)
chr2 (60-157)||(27777226-27777323)
chr2 (60-157)||(27803711-27803808)
chr2 (60-157)||(27816984-27817081)
chr2 (60-157)||(39051962-39052059)
chr2 (17-151)||(260850-260984)
chr2 (60-157)||(9350122-9350219)
chr2 (60-157)||(12586814-12586911)
[»] chr3 (119 HSPs)
chr3 (200-521)||(16626838-16627158)
chr3 (200-521)||(18529999-18530320)
chr3 (219-509)||(15893060-15893350)
chr3 (219-520)||(8301618-8301919)
chr3 (10-160)||(16626648-16626798)
chr3 (10-160)||(18530354-18530504)
chr3 (219-520)||(8295578-8295879)
chr3 (219-520)||(18050865-18051166)
chr3 (219-520)||(4797007-4797308)
chr3 (219-520)||(15741436-15741737)
chr3 (219-520)||(35880369-35880670)
chr3 (10-160)||(4625910-4626060)
chr3 (10-160)||(31034259-31034409)
chr3 (10-160)||(32292718-32292868)
chr3 (222-520)||(4721234-4721532)
chr3 (10-160)||(17993926-17994076)
chr3 (10-160)||(5652353-5652503)
chr3 (219-520)||(29149109-29149410)
chr3 (219-520)||(18330277-18330573)
chr3 (222-520)||(6191919-6192217)
chr3 (211-520)||(8211344-8211653)
chr3 (210-334)||(17994126-17994250)
chr3 (222-520)||(28116314-28116612)
chr3 (219-334)||(4625736-4625851)
chr3 (222-520)||(7072815-7073113)
chr3 (211-520)||(18277398-18277707)
chr3 (211-520)||(18292699-18293008)
chr3 (211-520)||(18308000-18308309)
chr3 (210-334)||(5652179-5652303)
chr3 (211-430)||(20065739-20065958)
chr3 (211-509)||(10395750-10396048)
chr3 (222-520)||(47023056-47023354)
chr3 (38-160)||(15892876-15892998)
chr3 (255-469)||(22871264-22871478)
chr3 (255-469)||(22886323-22886537)
chr3 (255-436)||(5466672-5466853)
chr3 (255-460)||(5596756-5596961)
chr3 (222-334)||(5713016-5713128)
chr3 (222-334)||(5723926-5724038)
chr3 (222-334)||(5757439-5757551)
chr3 (222-334)||(5768330-5768442)
chr3 (222-472)||(7996213-7996463)
chr3 (38-160)||(8295938-8296060)
chr3 (38-160)||(8301437-8301559)
chr3 (222-472)||(10642721-10642971)
chr3 (255-437)||(18224877-18225059)
chr3 (38-160)||(18330635-18330757)
chr3 (231-520)||(21674296-21674585)
chr3 (17-160)||(4721597-4721740)
chr3 (17-160)||(22387727-22387870)
chr3 (38-160)||(4796823-4796945)
chr3 (342-520)||(5013315-5013493)
chr3 (330-508)||(6542939-6543117)
chr3 (38-160)||(15741264-15741386)
chr3 (38-160)||(17985126-17985248)
chr3 (255-437)||(17985346-17985528)
chr3 (38-160)||(18051228-18051350)
chr3 (255-437)||(28020964-28021146)
chr3 (222-460)||(36997446-36997684)
chr3 (336-437)||(4347155-4347256)
chr3 (38-159)||(6542632-6542753)
chr3 (17-160)||(5609471-5609614)
chr3 (17-160)||(6192282-6192425)
chr3 (222-469)||(11110718-11110965)
chr3 (330-469)||(18242381-18242520)
chr3 (17-160)||(18277201-18277344)
chr3 (17-160)||(18292502-18292645)
chr3 (17-160)||(18307803-18307946)
chr3 (330-469)||(20577327-20577466)
chr3 (17-160)||(28339268-28339411)
chr3 (17-160)||(29148904-29149047)
chr3 (17-160)||(31964622-31964765)
chr3 (17-160)||(50134220-50134363)
chr3 (38-160)||(35880732-35880854)
chr3 (330-460)||(51781674-51781804)
chr3 (17-160)||(4416885-4417028)
chr3 (38-157)||(5713196-5713315)
chr3 (38-157)||(5724106-5724225)
chr3 (38-157)||(5757252-5757371)
chr3 (38-157)||(5768143-5768262)
chr3 (17-160)||(10396099-10396242)
chr3 (17-160)||(28116103-28116246)
chr3 (38-157)||(36997247-36997366)
chr3 (330-436)||(4416603-4416709)
chr3 (38-160)||(7996528-7996650)
chr3 (38-160)||(10643036-10643158)
chr3 (330-460)||(24327822-24327952)
chr3 (330-436)||(28338989-28339095)
chr3 (330-436)||(31964938-31965044)
chr3 (38-160)||(47023419-47023541)
chr3 (330-436)||(50134536-50134642)
chr3 (222-406)||(29665342-29665526)
chr3 (330-433)||(5609787-5609890)
chr3 (17-160)||(7073178-7073321)
chr3 (17-160)||(21674659-21674802)
chr3 (330-460)||(51796762-51796893)
chr3 (17-157)||(11110498-11110638)
chr3 (211-359)||(22387921-22388069)
chr3 (17-160)||(4346836-4346979)
chr3 (330-469)||(48465569-48465708)
chr3 (211-509)||(32438771-32439069)
chr3 (38-159)||(18242706-18242827)
chr3 (211-359)||(4892977-4893125)
chr3 (38-158)||(5466953-5467073)
chr3 (17-157)||(48465896-48466036)
chr3 (17-160)||(22871005-22871148)
chr3 (17-160)||(22886064-22886207)
chr3 (17-160)||(28021241-28021384)
chr3 (38-97)||(51782052-51782111)
chr3 (18-160)||(4893176-4893318)
chr3 (38-151)||(5013687-5013800)
chr3 (38-159)||(5596527-5596648)
chr3 (60-157)||(20577039-20577136)
chr3 (60-157)||(29665162-29665259)
chr3 (60-159)||(20066010-20066109)
chr3 (46-97)||(51797141-51797192)
chr3 (17-151)||(8211713-8211847)
chr3 (38-160)||(18225157-18225279)
chr3 (18-160)||(32439120-32439262)
[»] chr1 (14 HSPs)
chr1 (200-521)||(20460748-20461069)
chr1 (200-521)||(16208319-16208640)
chr1 (17-160)||(20461085-20461228)
chr1 (10-160)||(16208132-16208282)
chr1 (10-160)||(20340436-20340586)
chr1 (10-160)||(28151866-28152016)
chr1 (200-334)||(20340626-20340760)
chr1 (222-520)||(41793624-41793922)
chr1 (330-469)||(10962362-10962501)
chr1 (17-160)||(41793416-41793559)
chr1 (330-469)||(51637910-51638049)
chr1 (255-460)||(28584682-28584887)
chr1 (38-160)||(28584985-28585107)
chr1 (38-160)||(10962674-10962796)
[»] chr4 (50 HSPs)
chr4 (200-519)||(15285219-15285538)
chr4 (200-521)||(15227529-15227850)
chr4 (200-521)||(1899916-1900237)
chr4 (200-521)||(14235819-14236140)
chr4 (10-160)||(15227890-15228040)
chr4 (10-160)||(15285029-15285179)
chr4 (219-520)||(14664675-14664976)
chr4 (219-520)||(17013657-17013958)
chr4 (10-160)||(1900277-1900427)
chr4 (224-521)||(15391650-15391948)
chr4 (219-520)||(24592624-24592925)
chr4 (10-160)||(24460706-24460856)
chr4 (10-157)||(15391439-15391586)
chr4 (10-160)||(14235626-14235776)
chr4 (219-520)||(6569510-6569811)
chr4 (210-334)||(24460906-24461030)
chr4 (211-520)||(14763609-14763918)
chr4 (211-520)||(36344817-36345126)
chr4 (238-520)||(19372918-19373200)
chr4 (222-520)||(27163633-27163931)
chr4 (228-469)||(54833098-54833339)
chr4 (17-160)||(17014020-17014163)
chr4 (222-520)||(5005527-5005825)
chr4 (255-520)||(14098198-14098463)
chr4 (222-437)||(30753482-30753697)
chr4 (255-437)||(31126867-31127049)
chr4 (17-160)||(14763412-14763555)
chr4 (38-160)||(24592443-24592565)
chr4 (255-460)||(18800971-18801176)
chr4 (38-160)||(14098561-14098683)
chr4 (38-160)||(14665038-14665160)
chr4 (330-460)||(33674234-33674364)
chr4 (330-508)||(40106062-40106240)
chr4 (17-160)||(5005893-5006036)
chr4 (17-160)||(6569873-6570016)
chr4 (222-437)||(21969441-21969656)
chr4 (38-160)||(27163446-27163568)
chr4 (38-159)||(18800742-18800863)
chr4 (38-157)||(30753777-30753896)
chr4 (330-469)||(39850331-39850470)
chr4 (38-160)||(31126647-31126769)
chr4 (17-157)||(33673906-33674046)
chr4 (17-159)||(36344623-36344765)
chr4 (38-160)||(40105767-40105889)
chr4 (18-160)||(24112682-24112824)
chr4 (18-160)||(34189069-34189211)
chr4 (17-159)||(54833408-54833550)
chr4 (60-157)||(39850661-39850758)
chr4 (211-359)||(24112483-24112631)
chr4 (211-359)||(34189262-34189410)
[»] scaffold0124 (4 HSPs)
scaffold0124 (200-521)||(20053-20374)
scaffold0124 (10-160)||(20393-20543)
scaffold0124 (219-520)||(30095-30396)
scaffold0124 (38-85)||(30532-30579)
[»] chr7 (63 HSPs)
chr7 (200-509)||(16040980-16041289)
chr7 (203-521)||(16450178-16450496)
chr7 (219-520)||(16518615-16518916)
chr7 (219-520)||(16503579-16503880)
chr7 (10-160)||(16449985-16450135)
chr7 (10-160)||(16041329-16041479)
chr7 (219-520)||(2154216-2154517)
chr7 (10-160)||(26484700-26484850)
chr7 (219-520)||(5127635-5127936)
chr7 (10-160)||(2108992-2109142)
chr7 (10-160)||(2775365-2775515)
chr7 (10-160)||(31088451-31088601)
chr7 (10-160)||(39211010-39211160)
chr7 (219-520)||(10917064-10917365)
chr7 (219-520)||(11424975-11425276)
chr7 (10-160)||(45733466-45733616)
chr7 (18-160)||(18540805-18540947)
chr7 (210-334)||(31088651-31088775)
chr7 (210-334)||(45733292-45733416)
chr7 (222-472)||(45387034-45387284)
chr7 (222-520)||(5147542-5147840)
chr7 (222-520)||(16736662-16736960)
chr7 (222-520)||(16751716-16752014)
chr7 (222-520)||(17523175-17523473)
chr7 (222-520)||(17529742-17530040)
chr7 (38-160)||(11424791-11424913)
chr7 (330-520)||(31124554-31124744)
chr7 (17-160)||(5127998-5128141)
chr7 (38-160)||(10916883-10917005)
chr7 (222-460)||(11441263-11441501)
chr7 (38-160)||(16503395-16503517)
chr7 (38-160)||(16518431-16518553)
chr7 (330-520)||(24592851-24593041)
chr7 (211-436)||(4145314-4145539)
chr7 (17-160)||(5147334-5147477)
chr7 (330-469)||(9618345-9618484)
chr7 (330-437)||(26275404-26275511)
chr7 (222-520)||(26434900-26435198)
chr7 (330-435)||(26320179-26320284)
chr7 (330-437)||(3445020-3445127)
chr7 (38-160)||(2154579-2154701)
chr7 (17-160)||(16736454-16736597)
chr7 (17-160)||(16751508-16751651)
chr7 (17-160)||(17523538-17523681)
chr7 (17-160)||(17529534-17529677)
chr7 (222-437)||(26485946-26486161)
chr7 (38-160)||(4145138-4145260)
chr7 (38-160)||(9618657-9618779)
chr7 (38-160)||(26275109-26275231)
chr7 (38-160)||(26319884-26320006)
chr7 (38-160)||(45387349-45387471)
chr7 (38-157)||(3445315-3445434)
chr7 (17-160)||(26435263-26435406)
chr7 (222-469)||(26538075-26538322)
chr7 (330-469)||(26670224-26670363)
chr7 (330-437)||(31564709-31564816)
chr7 (38-160)||(26669929-26670051)
chr7 (38-159)||(31564405-31564526)
chr7 (211-359)||(5159326-5159474)
chr7 (38-157)||(26537885-26538004)
chr7 (38-151)||(11441587-11441700)
chr7 (38-159)||(31124927-31125048)
chr7 (18-160)||(5159525-5159667)
[»] chr5 (100 HSPs)
chr5 (200-522)||(23891855-23892177)
chr5 (200-521)||(25198682-25199003)
chr5 (219-520)||(24688367-24688668)
chr5 (10-160)||(22888484-22888634)
chr5 (10-160)||(25199043-25199193)
chr5 (219-520)||(23752660-23752961)
chr5 (219-520)||(30934287-30934588)
chr5 (326-520)||(24951761-24951955)
chr5 (219-520)||(23718198-23718500)
chr5 (219-520)||(11549005-11549306)
chr5 (200-357)||(22888287-22888444)
chr5 (10-160)||(23892220-23892370)
chr5 (10-160)||(13184646-13184796)
chr5 (10-160)||(33877261-33877411)
chr5 (219-520)||(33777138-33777439)
chr5 (219-519)||(22999324-22999624)
chr5 (10-160)||(11325808-11325958)
chr5 (10-160)||(13440492-13440642)
chr5 (10-160)||(29889080-29889230)
chr5 (210-334)||(13184846-13184970)
chr5 (210-334)||(13440692-13440816)
chr5 (210-334)||(33877087-33877211)
chr5 (222-469)||(9548756-9549003)
chr5 (200-334)||(11325634-11325768)
chr5 (222-520)||(15658973-15659271)
chr5 (222-460)||(41674420-41674658)
chr5 (17-160)||(23752455-23752598)
chr5 (222-469)||(31431130-31431377)
chr5 (255-469)||(2510753-2510967)
chr5 (222-436)||(8665688-8665902)
chr5 (38-160)||(11549368-11549490)
chr5 (38-160)||(23718014-23718136)
chr5 (38-160)||(30934647-30934769)
chr5 (330-508)||(40473873-40474051)
chr5 (330-469)||(9317153-9317292)
chr5 (222-469)||(30168171-30168418)
chr5 (255-437)||(24681171-24681353)
chr5 (38-160)||(24688183-24688305)
chr5 (255-437)||(24723698-24723880)
chr5 (38-160)||(24970032-24970154)
chr5 (222-520)||(43077900-43078198)
chr5 (255-520)||(18375658-18375923)
chr5 (330-469)||(6874004-6874143)
chr5 (330-437)||(12131889-12131996)
chr5 (222-469)||(18500961-18501208)
chr5 (17-160)||(33777501-33777644)
chr5 (330-437)||(37771320-37771427)
chr5 (38-160)||(2511065-2511187)
chr5 (222-520)||(3789177-3789475)
chr5 (330-520)||(5637561-5637751)
chr5 (38-160)||(8665501-8665623)
chr5 (38-160)||(15758883-15759005)
chr5 (330-472)||(15759178-15759320)
chr5 (219-317)||(24969878-24969976)
chr5 (342-520)||(30151669-30151847)
chr5 (330-508)||(37358976-37359154)
chr5 (17-160)||(6874319-6874462)
chr5 (17-160)||(9548548-9548691)
chr5 (17-160)||(22999119-22999262)
chr5 (330-469)||(26480094-26480233)
chr5 (330-437)||(31826740-31826847)
chr5 (330-437)||(37671813-37671920)
chr5 (330-469)||(37754670-37754809)
chr5 (38-160)||(26480406-26480528)
chr5 (255-437)||(33516090-33516272)
chr5 (255-469)||(34616223-34616437)
chr5 (17-159)||(37671488-37671630)
chr5 (17-160)||(15658765-15658908)
chr5 (17-160)||(41674723-41674866)
chr5 (38-160)||(5637924-5638046)
chr5 (38-160)||(9317465-9317587)
chr5 (38-160)||(12132169-12132291)
chr5 (17-159)||(18500735-18500877)
chr5 (17-159)||(28649250-28649392)
chr5 (38-160)||(30152032-30152154)
chr5 (38-160)||(30168483-30168605)
chr5 (255-437)||(32599715-32599897)
chr5 (38-160)||(34616532-34616654)
chr5 (38-151)||(31431463-31431576)
chr5 (330-469)||(13325165-13325304)
chr5 (38-157)||(31826433-31826552)
chr5 (38-160)||(18375438-18375560)
chr5 (342-460)||(28648937-28649055)
chr5 (38-160)||(28959812-28959934)
chr5 (331-437)||(28960120-28960226)
chr5 (330-460)||(29967387-29967517)
chr5 (330-460)||(30029126-30029256)
chr5 (17-159)||(37770992-37771134)
chr5 (38-159)||(37358669-37358790)
chr5 (17-160)||(32599477-32599620)
chr5 (38-159)||(3789556-3789677)
chr5 (38-159)||(37754995-37755116)
chr5 (211-359)||(33292340-33292488)
chr5 (17-157)||(43078269-43078409)
chr5 (18-160)||(33292539-33292681)
chr5 (38-160)||(33516370-33516492)
chr5 (60-157)||(24681457-24681554)
chr5 (60-157)||(24723984-24724081)
chr5 (60-157)||(40473597-40473694)
chr5 (18-159)||(13324835-13324976)
[»] chr8 (43 HSPs)
chr8 (219-520)||(16283091-16283392)
chr8 (219-520)||(16277196-16277497)
chr8 (219-520)||(19687740-19688041)
chr8 (200-521)||(22081125-22081446)
chr8 (219-520)||(2137531-2137832)
chr8 (219-520)||(14557269-14557570)
chr8 (10-160)||(44563106-44563256)
chr8 (219-520)||(27609177-27609478)
chr8 (10-160)||(9354627-9354777)
chr8 (10-160)||(19659099-19659249)
chr8 (10-157)||(22080938-22081085)
chr8 (10-160)||(33244670-33244820)
chr8 (210-334)||(19659299-19659423)
chr8 (219-334)||(44562932-44563047)
chr8 (210-334)||(9354453-9354577)
chr8 (222-520)||(18710228-18710526)
chr8 (222-520)||(19674080-19674378)
chr8 (10-160)||(16283454-16283604)
chr8 (228-469)||(19286158-19286399)
chr8 (38-160)||(16277559-16277681)
chr8 (222-460)||(31490025-31490263)
chr8 (38-160)||(2137347-2137469)
chr8 (38-160)||(19688103-19688225)
chr8 (38-160)||(27608993-27609115)
chr8 (211-436)||(31354250-31354475)
chr8 (17-160)||(31354529-31354672)
chr8 (38-160)||(14557629-14557751)
chr8 (330-437)||(19208743-19208850)
chr8 (342-469)||(28362350-28362477)
chr8 (330-508)||(3329902-3330080)
chr8 (38-160)||(19208448-19208570)
chr8 (330-508)||(29828967-29829145)
chr8 (38-160)||(31489838-31489960)
chr8 (330-469)||(19518526-19518665)
chr8 (17-160)||(19674446-19674589)
chr8 (38-160)||(28362043-28362165)
chr8 (330-460)||(33258425-33258555)
chr8 (38-159)||(3329595-3329716)
chr8 (17-160)||(18710591-18710734)
chr8 (330-520)||(12093116-12093306)
chr8 (38-159)||(12092812-12092933)
chr8 (17-159)||(19286468-19286610)
chr8 (37-159)||(29829328-29829450)
[»] scaffold0089 (6 HSPs)
scaffold0089 (219-520)||(29405-29706)
scaffold0089 (222-520)||(40385-40683)
scaffold0089 (219-520)||(47298-47599)
scaffold0089 (38-160)||(29768-29890)
scaffold0089 (38-160)||(40198-40320)
scaffold0089 (38-160)||(47114-47236)
[»] scaffold0109 (2 HSPs)
scaffold0109 (200-521)||(21208-21529)
scaffold0109 (10-157)||(21569-21716)
[»] scaffold0143 (2 HSPs)
scaffold0143 (219-520)||(26934-27235)
scaffold0143 (38-160)||(27297-27419)
[»] scaffold0558 (1 HSPs)
scaffold0558 (10-160)||(129-279)
[»] chr6 (88 HSPs)
chr6 (213-521)||(20160345-20160650)
chr6 (213-521)||(22172181-22172486)
chr6 (219-520)||(13299207-13299508)
chr6 (219-520)||(24863356-24863657)
chr6 (219-520)||(15424573-15424874)
chr6 (222-520)||(22935136-22935434)
chr6 (222-520)||(23857581-23857879)
chr6 (219-520)||(26988640-26988941)
chr6 (219-520)||(26999712-27000013)
chr6 (10-160)||(22456978-22457128)
chr6 (10-160)||(22477317-22477467)
chr6 (10-160)||(27290414-27290564)
chr6 (219-469)||(24304874-24305124)
chr6 (10-160)||(8892354-8892504)
chr6 (10-160)||(8903589-8903739)
chr6 (10-160)||(13522117-13522267)
chr6 (10-160)||(14143329-14143479)
chr6 (10-160)||(26787946-26788096)
chr6 (10-160)||(27196319-27196469)
chr6 (10-160)||(27252771-27252921)
chr6 (10-160)||(33374300-33374450)
chr6 (219-520)||(16749493-16749794)
chr6 (219-363)||(22477529-22477673)
chr6 (222-469)||(26918070-26918317)
chr6 (10-160)||(28162659-28162809)
chr6 (12-159)||(20160704-20160851)
chr6 (12-159)||(22171980-22172127)
chr6 (200-334)||(28162485-28162619)
chr6 (210-334)||(13522317-13522441)
chr6 (210-334)||(33374500-33374624)
chr6 (200-334)||(8892544-8892678)
chr6 (200-334)||(8903779-8903913)
chr6 (211-520)||(29549117-29549426)
chr6 (10-160)||(22934924-22935074)
chr6 (10-160)||(23857369-23857519)
chr6 (10-157)||(27272624-27272771)
chr6 (211-520)||(27044029-27044338)
chr6 (17-160)||(26918382-26918525)
chr6 (222-520)||(3695702-3696000)
chr6 (38-160)||(13299023-13299145)
chr6 (38-160)||(24304690-24304812)
chr6 (38-160)||(26989003-26989125)
chr6 (17-160)||(16749856-16749999)
chr6 (251-437)||(4525011-4525197)
chr6 (38-160)||(15424389-15424511)
chr6 (38-160)||(24863719-24863841)
chr6 (38-160)||(27000075-27000197)
chr6 (255-520)||(17024901-17025166)
chr6 (330-437)||(4757483-4757590)
chr6 (330-469)||(4772687-4772826)
chr6 (330-469)||(27007402-27007541)
chr6 (330-469)||(27484807-27484946)
chr6 (330-437)||(29572735-29572842)
chr6 (255-469)||(29501096-29501310)
chr6 (255-437)||(30558308-30558490)
chr6 (38-159)||(4525289-4525410)
chr6 (17-160)||(29549477-29549620)
chr6 (330-469)||(34463728-34463867)
chr6 (330-520)||(4546151-4546341)
chr6 (330-460)||(16944394-16944524)
chr6 (330-520)||(28207081-28207271)
chr6 (38-159)||(4773009-4773130)
chr6 (255-436)||(26777919-26778100)
chr6 (38-157)||(3696086-3696205)
chr6 (330-437)||(27360377-27360484)
chr6 (330-437)||(27450720-27450827)
chr6 (38-160)||(29573015-29573137)
chr6 (38-151)||(4545847-4545960)
chr6 (38-151)||(4724206-4724319)
chr6 (38-159)||(4757767-4757888)
chr6 (38-151)||(28207465-28207578)
chr6 (17-157)||(16674144-16674284)
chr6 (17-157)||(34463397-34463537)
chr6 (330-469)||(16673817-16673956)
chr6 (330-508)||(4724510-4724688)
chr6 (17-159)||(27007730-27007872)
chr6 (17-159)||(27044390-27044532)
chr6 (336-437)||(26116792-26116893)
chr6 (38-159)||(27485132-27485253)
chr6 (38-160)||(26777687-26777809)
chr6 (222-508)||(27629968-27630254)
chr6 (38-160)||(30558088-30558210)
chr6 (38-159)||(26116482-26116603)
chr6 (38-159)||(27360064-27360185)
chr6 (38-159)||(27450407-27450528)
chr6 (38-159)||(29501418-29501539)
chr6 (60-159)||(17025280-17025379)
chr6 (327-508)||(27272947-27273128)
[»] scaffold0260 (2 HSPs)
scaffold0260 (10-160)||(2759-2909)
scaffold0260 (200-334)||(2949-3083)
[»] scaffold0029 (2 HSPs)
scaffold0029 (219-520)||(443-744)
scaffold0029 (38-160)||(258-381)
[»] scaffold0415 (3 HSPs)
scaffold0415 (10-95)||(2018-2103)
scaffold0415 (330-469)||(5682-5821)
scaffold0415 (17-97)||(6080-6160)
[»] scaffold0336 (2 HSPs)
scaffold0336 (251-520)||(7874-8143)
scaffold0336 (17-160)||(9571-9714)
[»] scaffold0099 (1 HSPs)
scaffold0099 (326-520)||(48568-48769)
[»] scaffold0144 (2 HSPs)
scaffold0144 (330-520)||(26626-26816)
scaffold0144 (45-160)||(26338-26453)
[»] scaffold0237 (2 HSPs)
scaffold0237 (255-520)||(15279-15544)
scaffold0237 (38-160)||(15059-15181)
[»] scaffold0350 (2 HSPs)
scaffold0350 (330-437)||(7663-7770)
scaffold0350 (38-160)||(7368-7490)
[»] scaffold0159 (3 HSPs)
scaffold0159 (38-160)||(9195-9317)
scaffold0159 (38-160)||(20020-20142)
scaffold0159 (330-433)||(9490-9593)
[»] scaffold0038 (2 HSPs)
scaffold0038 (330-520)||(7579-7769)
scaffold0038 (38-151)||(7963-8076)
[»] scaffold0496 (1 HSPs)
scaffold0496 (330-370)||(157-197)


Alignment Details
Target: chr2 (Bit Score: 274; Significance: 1e-153; HSPs: 83)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 200 - 521
Target Start/End: Original strand, 19456701 - 19457022
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  19456701 catttgctaaacgatggcattaacgggcacctgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgaaagtattgc 19456800  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  19456801 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccctacttctgtttctt 19456900  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||    
T  19456901 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctaggcg 19457000  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  19457001 agtccccatggtgaccatctca 19457022  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 200 - 521
Target Start/End: Original strand, 21703444 - 21703765
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||| | ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||| ||    
T  21703444 catttgttgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 21703543  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||| ||||||||||||  ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  21703544 gcatatgggtacgacggaggtaactaggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 21703643  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    ||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  21703644 tcttcttatgatgaccgttaccgtatctctttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 21703743  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  21703744 agtccccatggtgaccatctca 21703765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 155; E-Value: 5e-82
Query Start/End: Original strand, 219 - 509
Target Start/End: Original strand, 27434746 - 27435036
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| | ||| |||||||||||||||||||||||||||||||||||| ||||  ||||||| ||||||||||||     
T  27434746 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggtggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 27434845  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  27434846 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 27434945  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 509  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| ||||||    
T  27434946 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatg 27435036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 19456511 - 19456661
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  19456511 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctatgagaagtagagt 19456610  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  19456611 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 19456661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 130; E-Value: 4e-67
Query Start/End: Original strand, 200 - 521
Target Start/End: Complemental strand, 27392951 - 27392630
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  ||| | |||||||| |||||||||||||| ||||||||||||||| ||||||||    
T  27392951 catttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggcggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 27392852  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
       ||| ||||||  |||  || ||| |||||||  || ||||||||||||||||  ||||||| || ||||||||||||||||||||||||||| ||||    
T  27392851 atgtactggtacggtggaggtagctgagcagcatcgatgggggcaacagtagccacagattgactggttccggcagataccatccctacttctgtctctt 27392752  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||| ||||| ||| || ||||||||||||| ||||||||| ||||||| || ||||||||||| ||||||| ||| |||||||  ||    
T  27392751 tcttcttatgatgaccattaccatacttccttgatgcatttgcagaggattcacctttctcaaacacaataatgccgtctctgacagcctcttctaagcg 27392652  T
Q  500 agtccccatgatgtccatctca 521  Q
     || |||||| || ||||||||    
T  27392651 ggttcccatggtgaccatctca 27392630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 23128868 - 23129169
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  23128868 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 23128967  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || |||||    
T  23128968 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccgtt 23129067  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  23129068 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 23129167  T
Q  519 tc 520  Q
    ||    
T  23129168 tc 23129169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 28882153 - 28881852
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  28882153 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 28882054  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  28882053 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 28881954  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || |||| ||||||||| |||||||| |||||| || |||||    
T  28881953 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacagcttcttccagacgagttcccatggtgaccatc 28881854  T
Q  519 tc 520  Q
    ||    
T  28881853 tc 28881852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 21703254 - 21703404
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  21703254 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgtcctgtctggttgtgcagtgccctctgagaagtagagt 21703353  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||| ||||| | ||||||||||||||| || |||||||||||    
T  21703354 cgggagtaactcagcatacaacattggtatcggagggaaggtaggtctagc 21703404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 20837857 - 20837556
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  20837857 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggat 20837758  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||| | || ||||| |||||||| |||||||||||||| || || || ||    
T  20837757 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccgactgacaccattcctacttccgtttctttcttcttgtggtgtccatt 20837658  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | | ||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||    
T  20837657 accatacctctttgatgcattcacagtggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatc 20837558  T
Q  519 tc 520  Q
    ||    
T  20837557 tc 20837556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 12655481 - 12655180
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  12655481 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggag 12655382  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||| | || ||||| |||||||| |||||||||||||| || || || ||    
T  12655381 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccgactgacaccattcctacttccgtttctttcttcttgtggtgtccatt 12655282  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | |||| |||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  12655281 accatacctctttgatgcattcacagagggttcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 12655182  T
Q  519 tc 520  Q
    ||    
T  12655181 tc 12655180  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 34303393 - 34303543
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  34303393 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 34303492  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  34303493 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 34303543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 100; E-Value: 3e-49
Query Start/End: Original strand, 10 - 157
Target Start/End: Complemental strand, 27393120 - 27392973
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||| | |||    
T  27393120 gatggaaatcgcacttgaggtcagaatggaacctgggaggcaacgggttaggtggaggcttgccctgcctggttgtgcagtgccctttgagaagcaaagt 27393021  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    |||||| | ||||||||| | |||||||||||||||||| ||||||||    
T  27393020 cgggagcagctcggcatacatcattggtatcggaggaaaggtaggtct 27392973  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 3784805 - 3784655
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  3784805 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 3784706  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  3784705 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 3784655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 16163750 - 16163600
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  16163750 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 16163651  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  16163650 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 16163600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 34157162 - 34157012
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  34157162 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 34157063  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  34157062 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 34157012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 27118839 - 27118689
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  27118839 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 27118740  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||| | ||| ||||||||||| || |||||||||||    
T  27118739 cgggagtaattcagcatacaacatcggtatcggagggaaggtaggtctagc 27118689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 31891446 - 31891568
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| || ||||||| |||||||    
T  31891446 gaaccttggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagtcgggagtaattcagcatataacattggt 31891545  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    ||| ||||||| |||||||||||    
T  31891546 atcagaggaaaggtaggtctagc 31891568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 200 - 334
Target Start/End: Original strand, 31891608 - 31891742
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||| ||| ||||| ||| |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||    
T  31891608 cattcgctgaacgacggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 31891707  T
Q  300 gcatacgggtacgacggaaataactgggcagcatt 334  Q
    ||||||||||||||||||  || ||| ||||||||    
T  31891708 gcatacgggtacgacggaggtagctgagcagcatt 31891742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 200 - 334
Target Start/End: Complemental strand, 27118649 - 27118515
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||    
T  27118649 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 27118550  T
Q  300 gcatacgggtacgacggaaataactgggcagcatt 334  Q
    |||| |||||||||||||  || ||| ||||||||    
T  27118549 gcatgcgggtacgacggaggtagctgagcagcatt 27118515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Complemental strand, 3784605 - 3784481
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  3784605 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 3784506  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  3784505 acgacggaggtagctgagcagcatt 3784481  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Complemental strand, 34156962 - 34156838
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  34156962 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 34156863  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  34156862 acgacggaggtagctgagcagcatt 34156838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #22
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 219 - 334
Target Start/End: Original strand, 34303602 - 34303717
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||     
T  34303602 ttaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggag 34303701  T
Q  319 ataactgggcagcatt 334  Q
     || ||| ||||||||    
T  34303702 gtagctgagcagcatt 34303717  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #23
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 210 - 334
Target Start/End: Complemental strand, 16163550 - 16163426
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | || ||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  16163550 acgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 16163451  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  16163450 acgacggaggtagctgagcagcatt 16163426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #24
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 34279385 - 34279087
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  34279385 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 34279286  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  34279285 tttgagctgcattgataggagcaacagtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 34279186  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| || | |||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  34279185 atacctcttcgacgtattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 34279087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #25
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 222 - 469
Target Start/End: Original strand, 13936849 - 13937096
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  13936849 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 13936948  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  13936949 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 13937048  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  13937049 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 13937096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #26
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 222 - 436
Target Start/End: Original strand, 21677487 - 21677701
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||  ||| ||||| | ||||   |    
T  21677487 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 21677586  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  21677587 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 21677686  T
Q  422 gtacctctttgatgc 436  Q
     |||||||| |||||    
T  21677687 atacctcttcgatgc 21677701  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #27
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 336 - 520
Target Start/End: Complemental strand, 37374983 - 37374799
Alignment:
Q  336 ataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatg 435  Q
    ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||    
T  37374983 ataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatg 37374884  T
Q  436 catttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    ||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  37374883 cattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 37374799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #28
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 222 - 469
Target Start/End: Original strand, 261070 - 261317
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||| ||||||   |    
T  261070 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 261169  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  261170 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 261269  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     |||||||| ||||||||  | ||||||||| ||||||| || |||||    
T  261270 atacctcttcgatgcattcacagaggattcagctttctcaaacacaat 261317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #29
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 11635494 - 11635792
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  11635494 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 11635593  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| | |||||||||||| || || || |||||    
T  11635594 tttgagctgcattgataggagcaacggtagccatggattgaccggctcctgctgacaccatccccacttccgcttctttcttcttgtggtgtccattacc 11635693  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     ||||||||  | ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  11635694 atacctcttcaacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 11635792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #30
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 11641683 - 11641981
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  11641683 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 11641782  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| | |||||||||||| || || || |||||    
T  11641783 tttgagctgcattgataggagcaacggtagccatggattgaccggctcctgctgacaccatccccacttccgcttctttcttcttgtggtgtccattacc 11641882  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     ||||||||  | ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  11641883 atacctcttcaacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 11641981  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #31
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 28882337 - 28882215
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28882337 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 28882238  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  28882237 atcggagggaaagtaggtctagc 28882215  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #32
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 222 - 469
Target Start/End: Complemental strand, 34286290 - 34286043
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||||||  ||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||  | ||  ||  ||| ||||| ||||||   |    
T  34286290 acgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatgggtatgacggaggca 34286191  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||| ||||||||||||||||||||  | || |||||||||||||| |||||||||||||| || || || |||||    
T  34286190 tttgagccgcattgataggagcaacagtggccatggattgaccggctccacctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 34286091  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  34286090 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 34286043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #33
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 222 - 469
Target Start/End: Complemental strand, 34291350 - 34291103
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||||||  ||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||  | ||  ||  ||| ||||| ||||||   |    
T  34291350 acgggtactggaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgggaatacggcatatatgggtatgacggaggca 34291251  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||| ||||||||||||||||||||  | || |||||||||||||| |||||||||||||| || || || |||||    
T  34291250 tttgagccgcattgataggagcaacagtggccatggattgaccggctccacctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 34291151  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  34291150 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 34291103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #34
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 12655665 - 12655543
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  12655665 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 12655566  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  12655565 atcggagggaaagtaggtctagc 12655543  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #35
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 255 - 437
Target Start/End: Original strand, 12716943 - 12717125
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  12716943 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 12717042  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  12717043 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 12717125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #36
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 23128684 - 23128806
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  23128684 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 23128783  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  23128784 atcggagggaaagtaggtctagc 23128806  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #37
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 27434534 - 27434684
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||| ||   |||| ||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||     
T  27434534 gatggaaatcacatttgaggtcggacctgaacttgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagc 27434633  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||| || ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  27434634 cggaagcaactcagcatacaacatcggtatcggagggaaagtaggtctagc 27434684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #38
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 11635283 - 11635426
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  11635283 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11635382  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  11635383 aactcagcatataacatcggtatcggagggaaagtaggtctagc 11635426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #39
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 222 - 469
Target Start/End: Complemental strand, 37925429 - 37925182
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |    
T  37925429 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggca 37925330  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  37925329 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 37925230  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  37925229 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 37925182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #40
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 20838041 - 20837919
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||||||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  20838041 gaacctgggaggcaacagatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 20837942  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  20837941 atcggagggaaagtaggtctagc 20837919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #41
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 21677300 - 21677422
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  21677300 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 21677399  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  21677400 atcggagggaaagtaggcctagc 21677422  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #42
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 11641472 - 11641615
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  11641472 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 11641571  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| |||  |||||||||| ||||||||||||||    
T  11641572 aactcagcatataacatctgtatcggagggaaagtaggtctagc 11641615  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #43
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 12586629 - 12586490
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| |||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  12586629 gcattgataggagcaacagtagtcatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 12586530  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  12586529 tcgacgcattcacagaggattcagctttctcaaacacaat 12586490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #44
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 22926125 - 22926268
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  22926125 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 22926224  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  22926225 aactcagcatataacatcggtatcggagggaaagtaggcctagc 22926268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #45
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Complemental strand, 31876109 - 31876002
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| |    
T  31876109 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttt 31876010  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  31876009 tcgatgca 31876002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #46
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 34279593 - 34279450
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34279593 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34279494  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  34279493 aactcagcatataacatcggtatcggagggaaagtaggtctagc 34279450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #47
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Complemental strand, 34861508 - 34861401
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| |    
T  34861508 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttt 34861409  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  34861408 tcgatgca 34861401  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #48
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 37686322 - 37686429
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| |    
T  37686322 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttt 37686421  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  37686422 tcgatgca 37686429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 37701587 - 37701694
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| |    
T  37701587 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttt 37701686  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  37701687 tcgatgca 37701694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Complemental strand, 39889890 - 39889783
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  39889890 gcattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 39889791  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  39889790 tcgatgca 39889783  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 469
Target Start/End: Complemental strand, 40233435 - 40233188
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||| ||||  ||  ||| ||||| ||||||   |    
T  40233435 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 40233336  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  40233335 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 40233236  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  40233235 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 40233188  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 10 - 157
Target Start/End: Complemental strand, 40233662 - 40233515
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| |||    
T  40233662 gatggaaatcacatttgaggtcagaccggaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagt 40233563  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
     || || | ||| ||||| | ||||||||| ||||||||||| |||||    
T  40233562 tggaagaagctcagcatacaacattggtataggaggaaaagttggtct 40233515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #53
Raw Score: 49; E-Value: 9e-19
Query Start/End: Original strand, 222 - 430
Target Start/End: Complemental strand, 32049734 - 32049526
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| | ||||   |    
T  32049734 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 32049635  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||| ||||| || || || |||||    
T  32049634 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttcttttttcttgtggtgtccattacc 32049535  T
Q  422 gtacctctt 430  Q
     ||||||||    
T  32049534 atacctctt 32049526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #54
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 330 - 469
Target Start/End: Original strand, 9350407 - 9350546
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  9350407 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 9350506  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  9350507 tcgacgcattcacagaggattcagctttctcaaacacaat 9350546  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #55
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 437
Target Start/End: Original strand, 16829763 - 16829858
Alignment:
Q  342 gcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  16829763 gcaacggtagccatggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 16829858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #56
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 342 - 437
Target Start/End: Complemental strand, 16891718 - 16891623
Alignment:
Q  342 gcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  16891718 gcaacggtagccatggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 16891623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 27777035 - 27776896
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27777035 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27776936  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  27776935 tcgacgcattcacagaggattcagctttctcaaacacaat 27776896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 27803520 - 27803381
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27803520 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27803421  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  27803420 tcgacgcattcacagaggattcagctttctcaaacacaat 27803381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #59
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 27816802 - 27816663
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27816802 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27816703  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  27816702 tcgacgcattcacagaggattcagctttctcaaacacaat 27816663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #60
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 34286498 - 34286355
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34286498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34286399  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  34286398 aactcagcatataacatcggtattggagggaaagtaggtctagc 34286355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #61
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 34291558 - 34291415
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  34291558 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 34291459  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  34291458 aactcagcatataacatcggtattggagggaaagtaggtctagc 34291415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #62
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 460
Target Start/End: Original strand, 19416912 - 19417042
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  19416912 gcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 19417011  T
Q  430 ttgatgcatttgcggaggattcaactttctc 460  Q
    | || |||||  | ||||||||| |||||||    
T  19417012 tcgacgcattcacagaggattcagctttctc 19417042  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #63
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 436
Target Start/End: Original strand, 22926441 - 22926547
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  22926441 gcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 22926540  T
Q  430 ttgatgc 436  Q
    | |||||    
T  22926541 tcgatgc 22926547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #64
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 34861803 - 34861681
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  34861803 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 34861704  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  34861703 atcggagggaaagtaggcctagc 34861681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #65
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 37686027 - 37686149
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  37686027 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37686126  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  37686127 atcggagggaaagtaggcctagc 37686149  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #66
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 37701292 - 37701414
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  37701292 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 37701391  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  37701392 atcggagggaaagtaggcctagc 37701414  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 37925616 - 37925494
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||| |  ||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
T  37925616 gaaccttggaggcaacgggtcgggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacattggt 37925517  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  37925516 atcggagggaaagtaggcctagc 37925494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 31876404 - 31876282
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  31876404 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 31876305  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || |||||||||||||| |||||    
T  31876304 ataggaggaaaagtaggcctagc 31876282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 37375305 - 37375163
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  37375305 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 37375206  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  37375205 agctctgcatacaacataggtataggaggaaaagttggtctag 37375163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #70
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 60 - 157
Target Start/End: Original strand, 13936684 - 13936781
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||||||||| |||||||||||    
T  13936684 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtatcggagggaaagtaggtct 13936781  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 216 - 469
Target Start/End: Original strand, 39052127 - 39052380
Alignment:
Q  216 gcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacg 315  Q
    ||||| ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||| ||||  ||  ||| ||||| ||||    
T  39052127 gcgttgacgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacg 39052226  T
Q  316 gaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgacc 415  Q
    ||   |  || || |||||  |||| ||||| || || || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || ||    
T  39052227 gaggcatttgagctgcattggtaggagcaacggttgctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtcc 39052326  T
Q  416 gttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     ||||| || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  39052327 attaccatatctcttcgacgcattcacagaggattcagctttctcaaacacaat 39052380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 16829456 - 16829578
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  16829456 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 16829555  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || |||||||||||||| |||||    
T  16829556 ataggaggaaaagtaggcctagc 16829578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 16892025 - 16891903
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  16892025 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 16891926  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || |||||||||||||| |||||    
T  16891925 ataggaggaaaagtaggcctagc 16891903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #74
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 32049921 - 32049799
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||| |  ||||| || || |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  32049921 gaaccttggaggcaacgggtccggtgggggtttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 32049822  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  32049821 atcggagggaaagtaggcctagc 32049799  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #75
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 39890197 - 39890075
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  39890197 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 39890098  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||||||||| ||||||||    
T  39890097 ataggaggaaaagttggtctagc 39890075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Original strand, 12716742 - 12716839
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  12716742 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 12716839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Complemental strand, 27777323 - 27777226
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27777323 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27777226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Complemental strand, 27803808 - 27803711
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27803808 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27803711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #79
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Complemental strand, 27817081 - 27816984
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  27817081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 27816984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #80
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Original strand, 39051962 - 39052059
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  39051962 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 39052059  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #81
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 17 - 151
Target Start/End: Original strand, 260850 - 260984
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  260850 atcacatttgagatcagacctgaaccttggaggcaacagatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 260949  T
Q  117 aactcggcatatagcattggtatcggaggaaaagt 151  Q
    |  || ||||| | ||||||||| |||||||||||    
T  260950 agttctgcatacaacattggtataggaggaaaagt 260984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #82
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 60 - 157
Target Start/End: Original strand, 9350122 - 9350219
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    |||||||||||||| || || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  9350122 ggtggaggcttgccttgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 9350219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #83
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 60 - 157
Target Start/End: Complemental strand, 12586911 - 12586814
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||  |||| ||||||| ||| ||||| ||||||||||| |||||    
T  12586911 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcgactcagcatataacatcggtataggaggaaaagttggtct 12586814  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 262; Significance: 1e-146; HSPs: 119)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 200 - 521
Target Start/End: Original strand, 16626838 - 16627158
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||||||| |||||||||||| ||||| ||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||     
T  16626838 catttgctgaacgatggcattaacgggtaccggaggttgacccgatggtagaggatactgatgatagaacggtggaaagaagggatgctgagagtattgt 16626937  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||||||||||||||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  16626938 gcatacgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttc-t 16627036  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||    
T  16627037 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctaggcg 16627136  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  16627137 agtccccatggtgaccatctca 16627158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 200 - 521
Target Start/End: Complemental strand, 18530320 - 18529999
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||| ||| |||||||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  18530320 catttgctgaacgacggcattaacgggcacttgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 18530221  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    |||||||||||||| |||  ||||||||||||||||||||||| ||||||||||||||||||||  | ||||||||||||||||||||||||||||||||    
T  18530220 gcatacgggtacgatggaggtaactgggcagcattaataggggtaacagtagccatggattgactagttccggcagataccatccctacttctgtttctt 18530121  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    ||||||||||||||||||||||||| ||||||||||||||| | |||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  18530120 tcttcttatgatgaccgttaccgtatctctttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 18530021  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  18530020 agtccccatggtgaccatctca 18529999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 147; E-Value: 3e-77
Query Start/End: Original strand, 219 - 509
Target Start/End: Original strand, 15893060 - 15893350
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| | ||| |||||||||||||| || |||||||||||||||||| ||||  ||||||| ||||||||||||     
T  15893060 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaagggcggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 15893159  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  15893160 gcatttgggcagcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 15893259  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 509  Q
    ||  |||||||||||||||||  | ||||||||| |||||||||| ||||| || |||||||||| ||||||||| |||||||| ||||||    
T  15893260 actatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacagcttcttccagacgagttcccatg 15893350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 8301618 - 8301919
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| | ||| ||||||||||||||||| |||||||||||||||||| | ||  ||||||| | ||||||||||     
T  8301618 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgagtacgacggag 8301717  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||| ||||| |||||| |||||||||||||||||||||||||||| ||||||| |||||| |||||||||||||| || || || ||    
T  8301718 gcatttgggcagcattgataggagcaacaatagccatggattgaccggctccggcagacaccatccatacttccgtttctttcttcttgtggtgtccatt 8301817  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| ||||||||||| |||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
T  8301818 accatacctctttgacgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 8301917  T
Q  519 tc 520  Q
    ||    
T  8301918 tc 8301919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 16626648 - 16626798
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16626648 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctaagaagtagagt 16626747  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     |||||||||||| |||||| |||||||||||||||||| |||||||||||    
T  16626748 agggagtaactcgacatatatcattggtatcggaggaaaggtaggtctagc 16626798  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 18530504 - 18530354
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  18530504 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 18530405  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    | |||||||||| ||||| | |||||||||||||||||| |||||||||||    
T  18530404 caggagtaactcagcatacaacattggtatcggaggaaaggtaggtctagc 18530354  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 8295879 - 8295578
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||| ||||| |||||| |||||| ||  ||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  8295879 ttaacaggtacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 8295780  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || || ||    
T  8295779 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 8295680  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || ||  |||  |||||||| |||||||| |||||| || |||||    
T  8295679 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccttgacggcttcttccagacgagttcccatggtgaccatc 8295580  T
Q  519 tc 520  Q
    ||    
T  8295579 tc 8295578  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 18051166 - 18050865
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||||||||| |||||||||||||| ||| | ||  ||||||| ||||| ||||||     
T  18051166 ttaacgggtacttgaggttgacccggtggcagagggtactgatgatagaatggcggaaagaaaggatgttgagaatacggcgcatatgggtatgacggag 18051067  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  18051066 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 18050967  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  18050966 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 18050867  T
Q  519 tc 520  Q
    ||    
T  18050866 tc 18050865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 4797007 - 4797308
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  4797007 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 4797106  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  4797107 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 4797206  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  4797207 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 4797306  T
Q  519 tc 520  Q
    ||    
T  4797307 tc 4797308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 15741436 - 15741737
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  15741436 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 15741535  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  15741536 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 15741635  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
     || |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  15741636 gccatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 15741735  T
Q  519 tc 520  Q
    ||    
T  15741736 tc 15741737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 35880670 - 35880369
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  35880670 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 35880571  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  35880570 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 35880471  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  35880470 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 35880371  T
Q  519 tc 520  Q
    ||    
T  35880370 tc 35880369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 4626060 - 4625910
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  4626060 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 4625961  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  4625960 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 4625910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 31034259 - 31034409
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||| ||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  31034259 gatggaaatcacatttgaggtcagaccggaacctaggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 31034358  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  31034359 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 31034409  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 32292868 - 32292718
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||| ||| ||||||||| ||||||||||||||||||||||||||||    
T  32292868 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggagacttcccctgtctgattgtgcagtgccctctgagaagtagagt 32292769  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  32292768 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 32292718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 4721532 - 4721234
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| ||||||||| |||||||| | ||  || |||| ||||| ||||||   |    
T  4721532 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaagatgctgagaatacggcacatatgggtatgacggaggca 4721433  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || |||||    
T  4721432 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 4721333  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  4721332 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatctc 4721234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 17993926 - 17994076
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  17993926 gatggaaatcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 17994025  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  17994026 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 17994076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 91; E-Value: 7e-44
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 5652503 - 5652353
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||| | ||||| ||||||||||||||||||||||||||||||| |||| ||||||||    
T  5652503 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtgaaggcttgccctgtctggttgtgcagtgccctttgaggagtagagt 5652404  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  5652403 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 5652353  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 90; E-Value: 3e-43
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 29149109 - 29149410
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    |||||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||||||||||||| | ||  || |||| ||||| ||||||     
T  29149109 ttaacgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcacatatgggtatgacggag 29149208  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| |||| |||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  29149209 gcatttgggctgcattgataggagcaatagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 29149308  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  29149309 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 29149408  T
Q  519 tc 520  Q
    ||    
T  29149409 tc 29149410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 86; E-Value: 7e-41
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 18330573 - 18330277
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| |||||     ||||||| |||||||||||||||||||||||| | ||  || |||| ||||| ||||||     
T  18330573 ttaacgggtacttgaggttgacccggtggcagagg-----gatgataaaatggtggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 18330479  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  18330478 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 18330379  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||  ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  18330378 accatacctcttcgatgcattcacagaggattcagctttctcgagcacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 18330279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #20
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 6192217 - 6191919
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| |||| |||||| ||||| | |||||||||||||||| | ||  || |||| ||||| ||||||   |    
T  6192217 acgggtacttgaggttgacccggtggcagagggtactaatgataaaatggcgaaaagaaaggatgctgagaatacggcacatatgggtatgacggaggca 6192118  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||||||||||||||||||||||||  | || ||||||| |||||| |||||||||||||| || || || |||||    
T  6192117 tttgagctgcattgataggagcaacagtagccatggattgaccggctccaactgacaccatccatacttccgtttctttcttcttgtggtgtccattacc 6192018  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  6192017 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatctc 6191919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #21
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 211 - 520
Target Start/End: Complemental strand, 8211653 - 8211344
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  ||||||| |||||    
T  8211653 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcgcatatgggta 8211554  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  8211553 tgacggaggcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 8211454  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 510  Q
    || || ||||| |||||||| |||||| | || ||||| ||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
T  8211453 tgtccattaccatacctcttcgatgcactcgcagaggactcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 8211354  T
Q  511 tgtccatctc 520  Q
    || |||||||    
T  8211353 tgaccatctc 8211344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #22
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Original strand, 17994126 - 17994250
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  17994126 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 17994225  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  17994226 acgacggaggtagctgagcagcatt 17994250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #23
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 28116314 - 28116612
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  28116314 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 28116413  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  28116414 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 28116513  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| |||||| | |  || |||||| ||||||| || |||||||| || || ||||  ||||| || ||||| || |||||| || |||||||    
T  28116514 atacctcttcgatgcactcgtagaagattcagctttctcaaacacaataattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 28116612  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #24
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 219 - 334
Target Start/End: Complemental strand, 4625851 - 4625736
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    |||||||||||||||||| |||||||||| | ||||||||||||||| |||||||||||||| ||||||||| ||||||||||||||| ||||||||||     
T  4625851 ttaacgggtacctgaggttgacccgatggcaaaggatactgatgatataatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggag 4625752  T
Q  319 ataactgggcagcatt 334  Q
     || ||| ||||||||    
T  4625751 gtagctgagcagcatt 4625736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #25
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 7073113 - 7072815
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  7073113 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 7073014  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||||||||||||||||| |||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  7073013 tttgagctgcattgataggagcaacagtagccatggattgactggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 7072914  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| || |||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  7072913 atacctcttcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 7072815  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #26
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 211 - 520
Target Start/End: Original strand, 18277398 - 18277707
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| |||||    
T  18277398 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18277497  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  18277498 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18277597  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 510  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  18277598 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18277697  T
Q  511 tgtccatctc 520  Q
    || |||||||    
T  18277698 tgaccatctc 18277707  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #27
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 211 - 520
Target Start/End: Original strand, 18292699 - 18293008
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| |||||    
T  18292699 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18292798  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  18292799 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18292898  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 510  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  18292899 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18292998  T
Q  511 tgtccatctc 520  Q
    || |||||||    
T  18292999 tgaccatctc 18293008  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #28
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 211 - 520
Target Start/End: Original strand, 18308000 - 18308309
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| |||||    
T  18308000 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 18308099  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  18308100 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 18308199  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 510  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  18308200 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 18308299  T
Q  511 tgtccatctc 520  Q
    || |||||||    
T  18308300 tgaccatctc 18308309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #29
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 210 - 334
Target Start/End: Complemental strand, 5652303 - 5652179
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||| | | | |||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  5652303 acgacggcattaacgggtacctgaggttgacccgattgcaaacgatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 5652204  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  5652203 acgacggaggtagctgagcagcatt 5652179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #30
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 211 - 430
Target Start/End: Complemental strand, 20065958 - 20065739
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| |||||    
T  20065958 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggta 20065859  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  ||||| ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| || ||||||||||| |||    
T  20065858 tgacggaggcatttgggctgcattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtatctttcttcttgtga 20065759  T
Q  411 tgaccgttaccgtacctctt 430  Q
    || || ||||| ||||||||    
T  20065758 tgtccattaccatacctctt 20065739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #31
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 211 - 509
Target Start/End: Complemental strand, 10396048 - 10395750
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| ||||| |||||||||||||||||  | ||  ||  ||| |||||    
T  10396048 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaatggcggaaagaaaggatgctgggaatacggcatatatgggta 10395949  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || || ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  10395948 tgacggaggcatttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 10395849  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 509  Q
    || || ||||| || ||||| ||||||||  | ||||||||| ||||||| || |||||||| || || ||||  ||||| || ||||| || ||||||    
T  10395848 tgtccattaccatatctcttcgatgcattcacagaggattcagctttctcaaacacaataattccatccctgacggcttcctcaagacgggttcccatg 10395750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #32
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 47023354 - 47023056
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| ||||||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||| ||||||   |    
T  47023354 acgggcacctgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 47023255  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  47023254 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 47023155  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| ||||||||  | ||||||||  ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  47023154 atacctcttcgatgcattcacagaggattcggctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 47023056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #33
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 15892876 - 15892998
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    ||||||||||||||| |||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | |||||||    
T  15892876 gaacctgggaggcaaaggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacattggt 15892975  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  15892976 atcggagggaaagtaggtctagc 15892998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #34
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 255 - 469
Target Start/End: Original strand, 22871264 - 22871478
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   | ||| || ||||| ||||| |||||||||||||    
T  22871264 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22871363  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || ||||||||| |    
T  22871364 tagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcagc 22871463  T
Q  455 tttctcgaatacaat 469  Q
    |||||| || |||||    
T  22871464 tttctcaaacacaat 22871478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #35
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 255 - 469
Target Start/End: Original strand, 22886323 - 22886537
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   | ||| || ||||| ||||| |||||||||||||    
T  22886323 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatctgagctgcattgataggtgcaacagtagcca 22886422  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || ||||||||| |    
T  22886423 tagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcagc 22886522  T
Q  455 tttctcgaatacaat 469  Q
    |||||| || |||||    
T  22886523 tttctcaaacacaat 22886537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #36
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 436
Target Start/End: Complemental strand, 5466853 - 5466672
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| |||||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  5466853 tactgatgataaaatggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 5466754  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 436  Q
    | ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| ||||||||||||||    
T  5466753 tagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgc 5466672  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #37
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 460
Target Start/End: Original strand, 5596756 - 5596961
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||||||||||   |  || || ||||| ||||| ||||| |||||||    
T  5596756 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtacgacggaggcatttgagctgcattgataggagcaacggtagcca 5596855  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||| | || |||||||||||    
T  5596856 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcactcgcagaggattcaac 5596955  T
Q  455 tttctc 460  Q
    ||||||    
T  5596956 tttctc 5596961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #38
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 222 - 334
Target Start/End: Complemental strand, 5713128 - 5713016
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||  ||    
T  5713128 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5713029  T
Q  322 actgggcagcatt 334  Q
     ||| ||||||||    
T  5713028 gctgagcagcatt 5713016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #39
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 222 - 334
Target Start/End: Complemental strand, 5724038 - 5723926
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||  ||    
T  5724038 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5723939  T
Q  322 actgggcagcatt 334  Q
     ||| ||||||||    
T  5723938 gctgagcagcatt 5723926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #40
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 222 - 334
Target Start/End: Original strand, 5757439 - 5757551
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||  ||    
T  5757439 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5757538  T
Q  322 actgggcagcatt 334  Q
     ||| ||||||||    
T  5757539 gctgagcagcatt 5757551  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #41
Raw Score: 61; E-Value: 6e-26
Query Start/End: Original strand, 222 - 334
Target Start/End: Original strand, 5768330 - 5768442
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| |||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||||||||||  ||    
T  5768330 acgggcacttgaggttgacccggtggcagagggtactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgtacgacggaggta 5768429  T
Q  322 actgggcagcatt 334  Q
     ||| ||||||||    
T  5768430 gctgagcagcatt 5768442  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #42
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 222 - 472
Target Start/End: Complemental strand, 7996463 - 7996213
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| | ||||   |    
T  7996463 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 7996364  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  7996363 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 7996264  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 472  Q
     |||||||| || ||| | || || |||||| ||||||| || ||||||||    
T  7996263 atacctcttcgaggcactcgcagaagattcagctttctcaaacacaataat 7996213  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #43
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 8296060 - 8295938
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||||||||||||| ||| |||| | |||||||||||||||||||| || ||||||||| | |||| |||||| || ||||| ||||| | ||| |||    
T  8296060 gaacctgggaggcaacagatcaggtaggggcttgccctgtctggttgtacaatgccctctgtggagtaaagtcggaagcaactcagcatacaacatcggt 8295961  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  8295960 atcggagggaaagtaggtctagc 8295938  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #44
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 8301437 - 8301559
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  8301437 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 8301536  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  8301537 atcggagggaaagtaggtctagc 8301559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #45
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 222 - 472
Target Start/End: Complemental strand, 10642971 - 10642721
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| | ||||   |    
T  10642971 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 10642872  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  10642871 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 10642772  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 472  Q
     |||||||| || ||| | || || |||||| ||||||| || ||||||||    
T  10642771 atacctcttcgaggcactcgcagaagattcagctttctcaaacacaataat 10642721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #46
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 255 - 437
Target Start/End: Complemental strand, 18225059 - 18224877
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  18225059 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 18224960  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || ||||||    
T  18224959 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgca 18224877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #47
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 18330757 - 18330635
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | ||||  ||||| || ||||| ||||||| ||| |||    
T  18330757 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaggtcggaagcaactcagcatataacatcggt 18330658  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  18330657 atcggagggaaagtaggtctagc 18330635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #48
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 231 - 520
Target Start/End: Complemental strand, 21674585 - 21674296
Alignment:
Q  231 tgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcag 330  Q
    |||||| |||||| ||| || || |||||||| || ||||| |||||||| ||||||||| | ||  || |||| ||||| ||||||   |  || || |    
T  21674585 tgaggttgacccggtggcagggggtactgatggtaaaatggcggaaagaacggatgctgagaatacggcacatatgggtatgacggaggcatttgagctg 21674486  T
Q  331 cattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctt 430  Q
    |||| ||||| || || |||||||||| |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || |||||    
T  21674485 cattgataggagccacggtagccatgggttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctctt 21674386  T
Q  431 tgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     ||||||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  21674385 cgatgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 21674296  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #49
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 4721740 - 4721597
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| |||||||| ||   |||||| ||||||| ||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  4721740 atcacatttgaggtcggacctgaaccttggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 4721641  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  4721640 aactcagcatataacatcggtatcggagggaaagtaggtctagc 4721597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #50
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 22387727 - 22387870
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  22387727 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 22387826  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||| | ||||||||| ||||||||||| ||||||||    
T  22387827 aactctgcatacaacattggtataggaggaaaagtcggtctagc 22387870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 4796823 - 4796945
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  4796823 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 4796922  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  4796923 atcggagggaaagtaggtctagc 4796945  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 342 - 520
Target Start/End: Complemental strand, 5013493 - 5013315
Alignment:
Q  342 gcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttg 441  Q
    |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |    
T  5013493 gcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcg 5013394  T
Q  442 cggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
      || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  5013393 tagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5013315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 330 - 508
Target Start/End: Original strand, 6542939 - 6543117
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  6542939 gcattgataggtgcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 6543038  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
    | |||||| | |  || |||||| ||||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
T  6543039 tcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccat 6543117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 15741264 - 15741386
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| |||||||||| || |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  15741264 gaaccttggaggcaacgaatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 15741363  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  15741364 atcggagggaaagtaggtctagc 15741386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 17985126 - 17985248
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  17985126 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 17985225  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||||||||||||||||||    
T  17985226 ataggaggaaaagtaggtctagc 17985248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 255 - 437
Target Start/End: Original strand, 17985346 - 17985528
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
T  17985346 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 17985445  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| |||||||||    
T  17985446 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctttttgatgca 17985528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #57
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 18051350 - 18051228
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||||||||||| ||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  18051350 gaacctgggaggcagcggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 18051251  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  18051250 atcggagggaaagtaggtctagc 18051228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #58
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 255 - 437
Target Start/End: Complemental strand, 28021146 - 28020964
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |  ||||| | ||| ||||| |||||||||||||    
T  28021146 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgtattgataggagcaacagtagcca 28021047  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    ||||||| |||||||| || || |||||||| ||||| ||||| |||||||| || || |||||||| |||||||||||||||    
T  28021046 tggattgcccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccgttaccatacctctttgatgca 28020964  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #59
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 460
Target Start/End: Original strand, 36997446 - 36997684
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| ||||||||| | || | ||| ||||| ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||| ||||||   |    
T  36997446 acgggcacctgaggttggccgggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 36997545  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  36997546 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 36997645  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctc 460  Q
     || ||||| || |||||| | ||||||||| |||||||    
T  36997646 atatctcttcgacgcatttacagaggattcagctttctc 36997684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #60
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 336 - 437
Target Start/End: Original strand, 4347155 - 4347256
Alignment:
Q  336 ataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatg 435  Q
    ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||    
T  4347155 ataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatg 4347254  T
Q  436 ca 437  Q
    ||    
T  4347255 ca 4347256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #61
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 6542632 - 6542753
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  6542632 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 6542731  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  6542732 ataggaggaaaagttggtctag 6542753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #62
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 5609471 - 5609614
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  5609471 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 5609570  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  5609571 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5609614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #63
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 6192425 - 6192282
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| |||||||| ||   |||||| ||||||| | ||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  6192425 atcacatttgaggtcggacctgaaccttggaggcagcagatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 6192326  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  6192325 aactcagcatataacatcggtatcggagggaaagtaggtctagc 6192282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #64
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 222 - 469
Target Start/End: Original strand, 11110718 - 11110965
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||| ||||||   |    
T  11110718 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 11110817  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || |  ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| ||||| |||||||| || || || |||||    
T  11110818 tttgagttgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccattacc 11110917  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  11110918 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 11110965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #65
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 18242520 - 18242381
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  18242520 gcattgataggagcaacggtagccattgattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 18242421  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  18242420 tcgacgcattcacagaggattcagctttctcaaacacaat 18242381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #66
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 18277201 - 18277344
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18277201 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18277300  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18277301 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18277344  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #67
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 18292502 - 18292645
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18292502 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18292601  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18292602 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18292645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #68
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 18307803 - 18307946
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||| ||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18307803 atcacatttgagatcagacctgaaccttggaggcaactgatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18307902  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  18307903 aactcagcatataacatcggtatcggagggaaagtaggtctagc 18307946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #69
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 469
Target Start/End: Original strand, 20577327 - 20577466
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  20577327 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 20577426  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  20577427 tcgacgcattcacagaggattcagctttctcaaacacaat 20577466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #70
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 28339411 - 28339268
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28339411 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28339312  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  28339311 aactcagcatataacatcggtatcggagggaaagtaggcctagc 28339268  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #71
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 29148904 - 29149047
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  29148904 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 29149003  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  29149004 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 29149047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #72
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 31964622 - 31964765
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  31964622 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31964721  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  31964722 aactcagcatataacatcggtatcggagggaaagtaggcctagc 31964765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #73
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 50134220 - 50134363
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  50134220 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 50134319  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  50134320 aactcagcatataacatcggtatcggagggaaagtaggcctagc 50134363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #74
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 35880854 - 35880732
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||| ||||| |||||| |||||||||||| ||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  35880854 gaaccttggaggcagcggatcaggtgggggcttgccctgtttggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 35880755  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  35880754 atcggagggaaagtaggtctagc 35880732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #75
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 330 - 460
Target Start/End: Complemental strand, 51781804 - 51781674
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  51781804 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 51781705  T
Q  430 ttgatgcatttgcggaggattcaactttctc 460  Q
    | || |||||| | ||||||||| |||||||    
T  51781704 tcgacgcatttacagaggattcagctttctc 51781674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #76
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 4417028 - 4416885
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  4417028 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 4416929  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  4416928 aactcagcatataacatcggtatcggagggaaagtaggcctagc 4416885  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #77
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 38 - 157
Target Start/End: Complemental strand, 5713315 - 5713196
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5713315 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5713216  T
Q  138 atcggaggaaaagtaggtct 157  Q
    |||||||| |||||||||||    
T  5713215 atcggagggaaagtaggtct 5713196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #78
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 38 - 157
Target Start/End: Complemental strand, 5724225 - 5724106
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5724225 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5724126  T
Q  138 atcggaggaaaagtaggtct 157  Q
    |||||||| |||||||||||    
T  5724125 atcggagggaaagtaggtct 5724106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #79
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 38 - 157
Target Start/End: Original strand, 5757252 - 5757371
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5757252 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5757351  T
Q  138 atcggaggaaaagtaggtct 157  Q
    |||||||| |||||||||||    
T  5757352 atcggagggaaagtaggtct 5757371  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #80
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 38 - 157
Target Start/End: Original strand, 5768143 - 5768262
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5768143 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagcaactcagcatataacatcggt 5768242  T
Q  138 atcggaggaaaagtaggtct 157  Q
    |||||||| |||||||||||    
T  5768243 atcggagggaaagtaggtct 5768262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #81
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 10396242 - 10396099
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||||||||| |||||  | |||| ||| || ||     
T  10396242 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtgcagtgtcctctctggagtaaagttggaaga 10396143  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    | ||| ||||| | ||| ||||||||||| ||||||||||||||    
T  10396142 agctctgcatacaacataggtatcggagggaaagtaggtctagc 10396099  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #82
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 28116103 - 28116246
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| | |||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28116103 atcacatttgagatcagacctgaaccttggaggcaacggatcaagtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 28116202  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  28116203 aattcagcatataacatcggtatcggagggaaagtaggtctagc 28116246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #83
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 38 - 157
Target Start/End: Original strand, 36997247 - 36997366
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  36997247 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 36997346  T
Q  138 atcggaggaaaagtaggtct 157  Q
    || ||||||||||| |||||    
T  36997347 ataggaggaaaagttggtct 36997366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #84
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 436
Target Start/End: Complemental strand, 4416709 - 4416603
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  4416709 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 4416610  T
Q  430 ttgatgc 436  Q
    | |||||    
T  4416609 tcgatgc 4416603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #85
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 7996650 - 7996528
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  7996650 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7996551  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  7996550 atcggagggaaagtaggcctagc 7996528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #86
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 10643158 - 10643036
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  10643158 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 10643059  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  10643058 atcggagggaaagtaggcctagc 10643036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #87
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 460
Target Start/End: Complemental strand, 24327952 - 24327822
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  24327952 gcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 24327853  T
Q  430 ttgatgcatttgcggaggattcaactttctc 460  Q
    | || |||||  | ||||||||| |||||||    
T  24327852 tcgacgcattcacagaggattcagctttctc 24327822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #88
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 436
Target Start/End: Complemental strand, 28339095 - 28338989
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  28339095 gcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 28338996  T
Q  430 ttgatgc 436  Q
    | |||||    
T  28338995 tcgatgc 28338989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #89
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 436
Target Start/End: Original strand, 31964938 - 31965044
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  31964938 gcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 31965037  T
Q  430 ttgatgc 436  Q
    | |||||    
T  31965038 tcgatgc 31965044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #90
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 47023541 - 47023419
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  47023541 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 47023442  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  47023441 atcggagggaaagtaggcctagc 47023419  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #91
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 436
Target Start/End: Original strand, 50134536 - 50134642
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  50134536 gcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 50134635  T
Q  430 ttgatgc 436  Q
    | |||||    
T  50134636 tcgatgc 50134642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #92
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 222 - 406
Target Start/End: Original strand, 29665342 - 29665526
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  ||   || ||||| ||||||   |    
T  29665342 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatgtatgggtatgacggaggca 29665441  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttctt 406  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| ||||||||||||||    
T  29665442 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttctt 29665526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #93
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 433
Target Start/End: Original strand, 5609787 - 5609890
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  5609787 gcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 5609886  T
Q  430 ttga 433  Q
    ||||    
T  5609887 ttga 5609890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #94
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 7073321 - 7073178
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||| || ||||| || ||||| || || || ||||||||  | |||| ||| || ||     
T  7073321 atcacatttgagatcagacctgaaccttggaggcaacggatcaggcgggggcttaccttgtctagtcgtacaatgccctctttggagtaaagttggaagc 7073222  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||||||||||||||||||    
T  7073221 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 7073178  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #95
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 21674802 - 21674659
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
T  21674802 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtagagttggaaga 21674703  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  21674702 agttctgcatacaacattggtataggaggaaaagttggtctagc 21674659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #96
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 460
Target Start/End: Complemental strand, 51796893 - 51796762
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg-accgttaccgtacctc 428  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || ||  || ||||| || |||    
T  51796893 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtgccattaccatatctc 51796794  T
Q  429 tttgatgcatttgcggaggattcaactttctc 460  Q
    || || |||||| | ||||||||| |||||||    
T  51796793 ttcgacgcatttacagaggattcagctttctc 51796762  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #97
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 17 - 157
Target Start/End: Original strand, 11110498 - 11110638
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||||||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  11110498 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 11110597  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  11110598 agttctgcatacaacattggtataggaggaaaagttggtct 11110638  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #98
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 211 - 359
Target Start/End: Original strand, 22387921 - 22388069
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || | ||| ||||| ||||||||| ||||| | ||||| |||||    
T  22387921 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacgatgggaagaacggatgctgagagtatggtgcataagggta 22388020  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 359  Q
     |||||    ||||| |||||||| ||||| ||||||||||||||||||    
T  22388021 ggacgggggaaactgagcagcattgataggagcaacagtagccatggat 22388069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #99
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 4346836 - 4346979
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  4346836 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 4346935  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  4346936 agttctgcatacaacattggtataggaggaaaagttggtctagc 4346979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #100
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 48465708 - 48465569
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || ||||| || ||||    
T  48465708 gcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatatctct 48465609  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  48465608 tcgacgcattcacagaggattcagctttctcaaacacaat 48465569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #101
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 211 - 509
Target Start/End: Complemental strand, 32439069 - 32438771
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  | ||||| |||||    
T  32439069 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 32438970  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     |||||    ||||| |||||||| | ||| |||||||||||| ||||| ||   | ||| || | || ||| || || || || ||||||||||| |||    
T  32438969 ggacgggggaaactgagcagcattgacaggagcaacagtagccttggatggattagttccagcggctatcattcccacctccgtatctttcttcttgtga 32438870  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatg 509  Q
    || || |||||||| ||||| |  |||||||| || || ||||  ||||| || ||||| |||||||| |  | ||||||||| ||||| || ||||||    
T  32438869 tgtccattaccgtatctcttcgcagcatttgcagatgactcaatcttctcaaacacaatgatgccttcccgaacagcttcttccagacgtgttcccatg 32438771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #102
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 18242827 - 18242706
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  18242827 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 18242728  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  18242727 ataggaggaaaagttggtctag 18242706  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #103
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 211 - 359
Target Start/End: Complemental strand, 4893125 - 4892977
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  | ||||| |||||    
T  4893125 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 4893026  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 359  Q
     |||||    ||||| |||||||| ||||| |||||||||||| |||||    
T  4893025 ggacgggggaaactgagcagcattgataggagcaacagtagccttggat 4892977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 38 - 158
Target Start/End: Complemental strand, 5467073 - 5466953
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | ||| |||    
T  5467073 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaaggagttctgcatacaacataggt 5466974  T
Q  138 atcggaggaaaagtaggtcta 158  Q
    ||  |||||||||| ||||||    
T  5466973 ataagaggaaaagttggtcta 5466953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 48466036 - 48465896
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  48466036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctttggagtaaagttggaaga 48465937  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  48465936 agttctgcatacaacattggtataggaggaaaagttggtct 48465896  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #106
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 22871005 - 22871148
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  22871005 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22871104  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  22871105 agttctgcatacaacattggtataggaggaaaagttggtctagc 22871148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #107
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 22886064 - 22886207
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  22886064 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 22886163  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  22886164 agttctgcatacaacattggtataggaggaaaagttggtctagc 22886207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #108
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 28021384 - 28021241
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||| || |||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  28021384 atcacatttgagatcagacctgaaccttggaggtaatggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtatagttggaaga 28021285  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  28021284 agttctgcatacaacattggtataggaggaaaagttggtctagc 28021241  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #109
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 38 - 97
Target Start/End: Complemental strand, 51782111 - 51782052
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 97  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  51782111 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51782052  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #110
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 4893318 - 4893176
Alignment:
Q  18 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 117  Q
    |||||||| || ||||| |||||||| ||||| || || |  |||||||| |||||||| || || |||||||| |||||  | |||| ||| || || |    
T  4893318 tcacacttaagatcagagtggaaccttggaggtaaagggtccggtggaggtttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 4893219  T
Q  118 actcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  4893218 gctctgcatacaacattggtataggaggaaaagttggtctagc 4893176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #111
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 38 - 151
Target Start/End: Complemental strand, 5013800 - 5013687
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  5013800 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagttccgcgtacaacattggt 5013701  T
Q  138 atcggaggaaaagt 151  Q
    || |||||||||||    
T  5013700 ataggaggaaaagt 5013687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #112
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 5596527 - 5596648
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  5596527 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 5596626  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||| || || |||||||    
T  5596627 ataggagggaaggttggtctag 5596648  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #113
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Original strand, 20577039 - 20577136
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  20577039 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 20577136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Original strand, 29665162 - 29665259
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  29665162 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 29665259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #115
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 60 - 159
Target Start/End: Complemental strand, 20066109 - 20066010
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || | ||| ||||| | ||||||||| ||||||||||| |||||||    
T  20066109 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaagctctgcatacaacattggtataggaggaaaagttggtctag 20066010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #116
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 46 - 97
Target Start/End: Complemental strand, 51797192 - 51797141
Alignment:
Q  46 gaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 97  Q
    |||||||||||| |||||| |||||||||||||| ||||| || ||||||||    
T  51797192 gaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctct 51797141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 17 - 151
Target Start/End: Complemental strand, 8211847 - 8211713
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| ||||| || || || || ||||||||  | |||||||| || ||     
T  8211847 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtacaatgccctctctggagtagagttggaaga 8211748  T
Q  117 aactcggcatatagcattggtatcggaggaaaagt 151  Q
    |  || ||||| | ||||||||| |||||||||||    
T  8211747 agttctgcatacaacattggtataggaggaaaagt 8211713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 18225279 - 18225157
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  18225279 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 18225180  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||| || ||||| |||||    
T  18225179 ataggagggaaggtaggcctagc 18225157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 32439262 - 32439120
Alignment:
Q  18 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 117  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  32439262 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 32439163  T
Q  118 actcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
      || ||||| | ||||||||| ||||||||||| ||||||||    
T  32439162 gttctgcatacaacattggtataggaggaaaagttggtctagc 32439120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 258; Significance: 1e-143; HSPs: 14)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 200 - 521
Target Start/End: Complemental strand, 20461069 - 20460748
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||||||| |||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||    
T  20461069 catttgctgaacgatggcattaacgggtacctgaggttgacccgatggtagaggatattgatgatagaatggtggaaagaaaggatgctgagagtattgc 20460970  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||||||||||| ||||  |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  20460969 gcatacgggtacggcggaggtaactgggcagcattaataggggcaatagtagccatggattgaccggctccggcagataccatccctacttctatttctt 20460870  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| ||    
T  20460869 tcttcttatgatgaccgttaccgtacctctttgatgcattggcggaggattcaactttctcgaatataataatgccttctctgacagcttcttctaggcg 20460770  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  20460769 agtccccatggtgaccatctca 20460748  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 218; E-Value: 1e-119
Query Start/End: Original strand, 200 - 521
Target Start/End: Original strand, 16208319 - 16208640
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||||||| |||| ||||||||||||  ||||||||||| | |||||||| |||||||||||||| ||||||||||||||| ||||||||    
T  16208319 catttgctgaacgatggcattaatgggtacctgaggctgacccgatggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 16208418  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
       ||| | |||| ||||  |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  16208419 atgtactgatacggcggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatctctacttctgtttctt 16208518  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    ||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||| |||||||||||||||    
T  16208519 tcttcttatgatgaccgttaccgtaactctttgatgcatttacagaggattcaactttctcaaatacaataatgccttctctgacagcttcttctagacg 16208618  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  16208619 agtccccatggtgaccatctca 16208640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 128; E-Value: 6e-66
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 20461228 - 20461085
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    ||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20461228 atcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 20461129  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||||||||| ||||||||||||| |||||||||||    
T  20461128 aactcggcatatagcattagtatcggaggaaaggtaggtctagc 20461085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 16208132 - 16208282
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||||||||||||    
T  16208132 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggttttccctgtctggttgtgcagtgccctctgagaagtagagt 16208231  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||||| ||| | |||||||||||||||||| |||||||||||    
T  16208232 cgggagtaactcggtatacaacattggtatcggaggaaaggtaggtctagc 16208282  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 20340436 - 20340586
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  20340436 gatggaaatcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 20340535  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     ||||||| |||||||||||||||||||||||||||||| |||||||||||    
T  20340536 tgggagtagctcggcatatagcattggtatcggaggaaaggtaggtctagc 20340586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 28152016 - 28151866
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||| ||||||||| ||| ||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  28152016 gatggaaatcacatttgaggtcagaccggagcctgggaggtaacagatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 28151917  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  28151916 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 28151866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 200 - 334
Target Start/End: Original strand, 20340626 - 20340760
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||| | ||||| ||| || ||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||    
T  20340626 catttgttgaacgacggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 20340725  T
Q  300 gcatacgggtacgacggaaataactgggcagcatt 334  Q
    || |||||||||||||||  || ||| ||||||||    
T  20340726 gcgtacgggtacgacggaggtagctgagcagcatt 20340760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 41793624 - 41793922
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||| ||| | ||  ||  ||| ||||| ||||||   |    
T  41793624 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgttgagaatacggcatatatgggtatgacggaggca 41793723  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      ||||| ||||| ||||| ||||| ||||||||||||||||||||||| || |||||||| || ||||| |||||||||||||| || || || |||||    
T  41793724 tttgggctgcattgataggagcaacggtagccatggattgaccggctccagctgataccattcccacttccgtttctttcttcttgtggtgtccattacc 41793823  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     ||||||||||||||| |  | |||| |||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  41793824 atacctctttgatgcactcacagaggtttcagctttctcaaacacaatgatcccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 41793922  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 10962501 - 10962362
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  10962501 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 10962402  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | ||||||||  | ||||||||| ||||||| || |||||    
T  10962401 tcgatgcattcacagaggattcagctttctcaaacacaat 10962362  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 41793416 - 41793559
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  41793416 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 41793515  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  41793516 aactcagcatataacatcggtatcggagggaaagtaggcctagc 41793559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 51638049 - 51637910
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  51638049 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 51637950  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || ||| |||| || |||||| ||||||| || |||||    
T  51637949 tcgacgcacttgcagaagattcagctttctcaaacacaat 51637910  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 255 - 460
Target Start/End: Complemental strand, 28584887 - 28584682
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||||||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  28584887 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatacgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 28584788  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  28584787 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 28584688  T
Q  455 tttctc 460  Q
    ||||||    
T  28584687 tttctc 28584682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 28585107 - 28584985
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28585107 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28585008  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  28585007 atcggagggaaagtaggcctagc 28584985  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 10962796 - 10962674
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | || | ||| || || ||||| ||||||| ||| |||    
T  10962796 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagcaaagttggaagcaactcagcatataacatcggt 10962697  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  10962696 atcggagggaaagtaggcctagc 10962674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 252; Significance: 1e-140; HSPs: 50)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 200 - 519
Target Start/End: Original strand, 15285219 - 15285538
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
T  15285219 catttgctgaacgatggcattaacgggcacctgaggttgacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 15285318  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||| |||||| | |||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||    
T  15285319 gcatatgggtacaatggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccatacttctgtttctt 15285418  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||    
T  15285419 tcttcttatgatgaccgttaccgttcctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctaggcg 15285518  T
Q  500 agtccccatgatgtccatct 519  Q
    |||||||||| || ||||||    
T  15285519 agtccccatggtgaccatct 15285538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 200 - 521
Target Start/End: Complemental strand, 15227850 - 15227529
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| |||||  || |||||||||||||||||| |||||||||| | |||||| ||||||||||||||||||||||| ||||||||| ||||||||    
T  15227850 catttgctgaacgacagcattaacgggtacctgaggttgacccgatggcaaaggatattgatgatagaatggtggaaagaagggatgctgagagtattgc 15227751  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
T  15227750 gcatacgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccagctccggcagataccatccctacttctgtttctt 15227651  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||    
T  15227650 tcttcttatgatgaccgttaccatgcctctttgatgcatttgcggaggattcatctttctcgaatacaataatgccttctctgacagcttcttctagacg 15227551  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  15227550 agtccccatggtgaccatctca 15227529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 200 - 521
Target Start/End: Complemental strand, 1900237 - 1899916
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||| ||    
T  1900237 catttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 1900138  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  1900137 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 1900038  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||| |||||||||||||||||||||||||| | ||||||||||||||||| |||||||||||||||||||||| ||||||||| | |||    
T  1900037 tcttcttatgatgatcgttaccgtacctctttgatgcatttacagaggattcaactttctcaaatacaataatgccttctctgacagcttcttccaaacg 1899938  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  1899937 agtccccatggtgaccatctca 1899916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 200 - 521
Target Start/End: Original strand, 14235819 - 14236140
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| | | ||||| |||||||||||||  ||  |||||||||||||||| |||||||||||||||||||| ||||||||||||||| ||||||||    
T  14235819 catttgctgagcaatggcattaacgggtacctatgggtgacccgatggtagagggtactgatgatagaatggtgggaagaaaggatgctgagagtattgc 14235918  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
      |||| |||||| | ||  |||||| |||||||||||||||| |||||| ||||||||||||| || ||||||||||||||||||||||||||| ||||    
T  14235919 atatactggtacggcagaggtaactgagcagcattaataggggtaacagtggccatggattgactggttccggcagataccatccctacttctgtctctt 14236018  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||| ||||||||| |||||||||   |||| ||||||||  |||||||||| ||||||||| ||||||||| ||| |||||||  ||    
T  14236019 tcttcttatgatgaccattaccgtacttctttgatgtgcttgcagaggattcccctttctcgaacacaataatgtcttctctgacagcctcttctaagcg 14236118  T
Q  500 agtccccatgatgtccatctca 521  Q
     || |||||| || ||||||||    
T  14236119 ggttcccatggtgaccatctca 14236140  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 15228040 - 15227890
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| |||||||||||||||| |||| |||||||||||| |||||||||||||| |||||||||||||||||||||||    
T  15228040 gatggaaatcacacttgaggtcagaacggaacctgggaggcaatggatcaggtggaggcttaccctgtctggttgtacagtgccctctgagaagtagagt 15227941  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  15227940 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 15227890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 15285029 - 15285179
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15285029 gatggaaatcacacttgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 15285128  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||||  |||||||||||||||||||||||| |||||||||||    
T  15285129 cgggagtaactcgaaatatagcattggtatcggaggaaaggtaggtctagc 15285179  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 14664976 - 14664675
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  | ||||| ||||| ||||||     
T  14664976 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggtgcatatgggtatgacggag 14664877  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || || ||    
T  14664876 gcatttgggcagcattgataggagcaacagtagccatggattgaccagctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 14664777  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| || |  ||||| || |||||||| |||||| || |||||    
T  14664776 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctaacggcttcctccagacgagttcccatggtgaccatc 14664677  T
Q  519 tc 520  Q
    ||    
T  14664676 tc 14664675  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 17013958 - 17013657
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| || |||     
T  17013958 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgaaggag 17013859  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||| |||||||| || |||||||||||||| |||||||||||||| || || || ||    
T  17013858 gcatttgggctgcattgataggagcaacagtagccatggattgaccagctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 17013759  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  17013758 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 17013659  T
Q  519 tc 520  Q
    ||    
T  17013658 tc 17013657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 1900427 - 1900277
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| | |||||| || ||||||||| |||||||||||| || |||||||||||||||||||||||||||||||||||    
T  1900427 gatggaaatcacacttgaggtcagaacgaaacctgagaagcaacggatcaggtggaggcttaccatgtctggttgtgcagtgccctctgagaagtagagt 1900328  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||||||||| |||||||||||||||||||| |||||||||||    
T  1900327 cgggagtaactcggcatacagcattggtatcggaggaaaggtaggtctagc 1900277  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 224 - 521
Target Start/End: Original strand, 15391650 - 15391948
Alignment:
Q  224 gggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataac 323  Q
    ||||||||||||| ||||||  | | | |||||||| ||||| |||||||| ||||||||||||||| ||||||||   ||| | |||| ||||  || |    
T  15391650 gggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgcatgtactgatacggcggaggtagc 15391749  T
Q  324 tgggcagcattaataggggcaa-cagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccg 422  Q
    || ||| |||| || ||||||| |||||||||||||||||| || ||| ||||||||||||||||||||||| |||||||||||||||||||| || ||     
T  15391750 tgagcaacattgatgggggcaaacagtagccatggattgactggttccagcagataccatccctacttctgtctctttcttcttatgatgaccattgcca 15391849  T
Q  423 tacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctca 521  Q
    ||| || ||||||||||||| ||||||||| ||||| | || ||||||||||| ||||||| ||| |||||||  || || |||||| || ||||||||    
T  15391850 tacttccttgatgcatttgcagaggattcacctttcccaaacacaataatgccatctctgacagcctcttctaagcgggttcccatggtgaccatctca 15391948  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 24592624 - 24592925
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  24592624 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 24592723  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  24592724 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 24592823  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
T  24592824 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 24592923  T
Q  519 tc 520  Q
    ||    
T  24592924 tc 24592925  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 24460706 - 24460856
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  24460706 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 24460805  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  24460806 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 24460856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 10 - 157
Target Start/End: Original strand, 15391439 - 15391586
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | |||    
T  15391439 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggcttcccctgcctggttgtgcagtgccctttgagaagcaaagt 15391538  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    |||||| |||||||| || |||||||||||||||||||| ||||||||    
T  15391539 cgggagcaactcggcgtacagcattggtatcggaggaaaggtaggtct 15391586  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 14235626 - 14235776
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| ||||||||  ||||||||||||||||||| || ||||||||||||||||||||||||||||| ||||||||| | ||||| |||||    
T  14235626 gatggaaatcacatttgaggtcgaaatggaacctgggaggcaaagggttaggtggaggcttgccctgtctggttgtacagtgccctttaagaagcagagt 14235725  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| | ||||||||| | |||||||||| ||||||| |||||||||||    
T  14235726 cgggagcagctcggcatacaacattggtatcagaggaaaggtaggtctagc 14235776  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 6569811 - 6569510
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||| | ||  ||  ||| ||||| ||||||     
T  6569811 ttaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggag 6569712  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||    
T  6569711 gcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccatt 6569612  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| || ||||| |||||||| || ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  6569611 accatatctcttcgatgcattcgcagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatc 6569512  T
Q  519 tc 520  Q
    ||    
T  6569511 tc 6569510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 210 - 334
Target Start/End: Original strand, 24460906 - 24461030
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | || ||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  24460906 acgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 24461005  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  24461006 acgacggaggtagctgagcagcatt 24461030  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 211 - 520
Target Start/End: Original strand, 14763609 - 14763918
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| |||||    
T  14763609 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 14763708  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  14763709 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 14763808  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 510  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  14763809 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 14763908  T
Q  511 tgtccatctc 520  Q
    || |||||||    
T  14763909 tgaccatctc 14763918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 211 - 520
Target Start/End: Original strand, 36344817 - 36345126
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||||||||||||||| || ||| | ||||| ||||||||| ||||  || |||| |||||    
T  36344817 cgatggcattgacaggaacctgaggttggcccggtggcaaaggatactgatgataaaacggtaggaagaacggatgctgagagtacggcacatatgggta 36344916  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || |  ||||| ||||| |||||||| ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  36344917 tgacggaggcatttgagttgcattgataggagcaacagtggccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 36345016  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 510  Q
    || || ||||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || ||||||     
T  36345017 tgtccattaccatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 36345116  T
Q  511 tgtccatctc 520  Q
    || |||||||    
T  36345117 tgaccatctc 36345126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 238 - 520
Target Start/End: Complemental strand, 19373200 - 19372918
Alignment:
Q  238 gacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaat 337  Q
    |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| ||||| ||||||   |  || || ||||| ||    
T  19373200 gacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgagctgcattgat 19373101  T
Q  338 aggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    ||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  19373100 aggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 19373001  T
Q  438 tttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    ||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  19373000 ttcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 19372918  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #20
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 27163633 - 27163931
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  27163633 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 27163732  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  27163733 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattacc 27163832  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    |||||| || |||||| | |  || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  27163833 gtaccttttcgatgcactcgtagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 27163931  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #21
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 228 - 469
Target Start/End: Complemental strand, 54833339 - 54833098
Alignment:
Q  228 acctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactggg 327  Q
    ||||||||| | |||| ||||| ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| ||||| ||||||   |  || |    
T  54833339 acctgaggttggcccggtggtaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 54833240  T
Q  328 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 427  Q
    | ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
T  54833239 ctgcattgataggagcaacagtggccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 54833140  T
Q  428 ctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    ||| || ||| | || || |||||| ||||||| || |||||    
T  54833139 cttcgacgcactcgcagaagattcagctttctcaaacacaat 54833098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #22
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 17014163 - 17014020
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  17014163 atcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctttggagtaaagtcggaagc 17014064  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  17014063 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 17014020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #23
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 5005825 - 5005527
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  5005825 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 5005726  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| || || ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  5005725 tttgagctgcattgatgggagcaacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 5005626  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| || | | | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  5005625 atacctcttcgacgtactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5005527  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #24
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 255 - 520
Target Start/End: Complemental strand, 14098463 - 14098198
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  14098463 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 14098364  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||| | ||||||||| |    
T  14098363 ttgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcatttacagaggattcagc 14098264  T
Q  455 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  14098263 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 14098198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #25
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 222 - 437
Target Start/End: Complemental strand, 30753697 - 30753482
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| ||||||  || ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  30753697 acgggcacttgaggttgacccggcggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 30753598  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || | |||||| ||||| |||||||||||||| || || || |||||    
T  30753597 tttgagctgcattgataggtgcaacagtagccatggattgaccggctccagctgacatcatccccacttccgtttctttcttcttgtggtgtccattacc 30753498  T
Q  422 gtacctctttgatgca 437  Q
     |||||||| ||||||    
T  30753497 atacctcttcgatgca 30753482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #26
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 255 - 437
Target Start/End: Original strand, 31126867 - 31127049
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  31126867 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagtagcca 31126966  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  31126967 ttgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 31127049  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #27
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 14763412 - 14763555
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  14763412 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 14763511  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  14763512 aactcagcatataacatcggtatcggagggaaagtaggtctagc 14763555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #28
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 24592443 - 24592565
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  24592443 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24592542  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  24592543 atcggagggaaagtaggtctagc 24592565  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #29
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 255 - 460
Target Start/End: Original strand, 18800971 - 18801176
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  18800971 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 18801070  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | | |||||||||||| || || |||||||| |||||||||||||||||||| || || || ||||| || ||||| || |||||  | ||||||||| |    
T  18801071 tagcttgaccggctccagctgacaccatccccacttctgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacagaggattcagc 18801170  T
Q  455 tttctc 460  Q
    ||||||    
T  18801171 tttctc 18801176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #30
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 14098683 - 14098561
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  14098683 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 14098584  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||||||||||||||||||    
T  14098583 ataggaggaaaagtaggtctagc 14098561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #31
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 14665160 - 14665038
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  14665160 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagcaactcagcatacaacatcggt 14665061  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  14665060 atcggagggaaagtaggtctagc 14665038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 330 - 460
Target Start/End: Original strand, 33674234 - 33674364
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  33674234 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 33674333  T
Q  430 ttgatgcatttgcggaggattcaactttctc 460  Q
    | || |||||| | ||||||||| |||||||    
T  33674334 tcgacgcatttacagaggattcagctttctc 33674364  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 330 - 508
Target Start/End: Original strand, 40106062 - 40106240
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || |  ||||||||||| |    
T  40106062 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtctattaccgtaccttt 40106161  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
    | |||||| | |  || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| ||||||||    
T  40106162 tcgatgcactcgtagaagattcagctttctcaaacacaatgattccatccctgactgcttcctcaagacgggtccccat 40106240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 5006036 - 5005893
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||| ||||| ||||| || ||||||||  | |||| ||| || ||     
T  5006036 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccttgtctagttgtacaatgccctctctggagtaaagttggaagc 5005937  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  5005936 aactcagcatataacatcggtatcggagggaaagtaggcctagc 5005893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 6570016 - 6569873
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  6570016 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 6569917  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||||||||||||||| ||||||||||||||    
T  6569916 agttctgcatacaacattggtatcggagggaaagtaggtctagc 6569873  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #36
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 437
Target Start/End: Complemental strand, 21969656 - 21969441
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || || || ||||||||||||||| | ||  ||  ||| ||||| | ||||   |    
T  21969656 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggcgggaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 21969557  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| || || |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||| ||||| || || || |||||    
T  21969556 tttgagctgcattgatgggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttcttttttcttgtggtgtccattacc 21969457  T
Q  422 gtacctctttgatgca 437  Q
     |||||||| ||||||    
T  21969456 atacctcttcgatgca 21969441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 27163446 - 27163568
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  27163446 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 27163545  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  27163546 atcggagggaaagtaggcctagc 27163568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 18800742 - 18800863
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
T  18800742 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 18800841  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  18800842 ataggaggaaaagttggtctag 18800863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #39
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 38 - 157
Target Start/End: Complemental strand, 30753896 - 30753777
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  30753896 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 30753797  T
Q  138 atcggaggaaaagtaggtct 157  Q
    || ||||||||||| |||||    
T  30753796 ataggaggaaaagttggtct 30753777  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #40
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 39850470 - 39850331
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || ||||| || ||||    
T  39850470 gcattgataggtgcaacagtagccattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatatctct 39850371  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || | |||  | ||||||||| ||||||| || |||||    
T  39850370 tcgacgtattcacagaggattcagctttctcaaacacaat 39850331  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #41
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 31126647 - 31126769
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||| | |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | |||||||    
T  31126647 gaaccttggaggcaacgggtcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggt 31126746  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || |||||||||||||| |||||    
T  31126747 ataggaggaaaagtaggcctagc 31126769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 17 - 157
Target Start/End: Original strand, 33673906 - 33674046
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||| |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || ||     
T  33673906 atcacatttgagatcagacctgaaccttggaggcaacgggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagc 33674005  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||    
T  33674006 aactcagcatacaacattggtataggaggaaaagttggtct 33674046  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #43
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 36344623 - 36344765
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  36344623 atcacatttgagatcagacctgaacctcggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 36344722  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  36344723 agctctgcatacaacataggtataggaggaaaagttggtctag 36344765  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #44
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 40105767 - 40105889
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || |  || ||||||| ||| |||    
T  40105767 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagaagttcagcatataacatcggt 40105866  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  40105867 atcggagggaaagtaggcctagc 40105889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #45
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 24112824 - 24112682
Alignment:
Q  18 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 117  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  24112824 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 24112725  T
Q  118 actcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  24112724 gctctgcatacaacattggtataggaggaaaagttggtctagc 24112682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #46
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 160
Target Start/End: Original strand, 34189069 - 34189211
Alignment:
Q  18 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 117  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  34189069 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 34189168  T
Q  118 actcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  34189169 gctctgcatacaacattggtataggaggaaaagttggtctagc 34189211  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #47
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 54833550 - 54833408
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
T  54833550 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 54833451  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  54833450 agctctgcatacaacataggtataggaggaaaagttggtctag 54833408  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #48
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Complemental strand, 39850758 - 39850661
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  39850758 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 39850661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #49
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 211 - 359
Target Start/End: Complemental strand, 24112631 - 24112483
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  | ||||| |||||    
T  24112631 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 24112532  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 359  Q
     |||||    ||||| |||||||| | ||| |||||||||||| |||||    
T  24112531 ggacgggggaaactgagcagcattgacaggagcaacagtagccttggat 24112483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #50
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 211 - 359
Target Start/End: Original strand, 34189262 - 34189410
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  | ||||| |||||    
T  34189262 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 34189361  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 359  Q
     |||||    ||||| |||||||| ||||| || ||||||||| |||||    
T  34189362 ggacgggggaaactgagcagcattgataggagcgacagtagccttggat 34189410  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124 (Bit Score: 250; Significance: 1e-138; HSPs: 4)
Name: scaffold0124
Description:

Target: scaffold0124; HSP #1
Raw Score: 250; E-Value: 1e-138
Query Start/End: Original strand, 200 - 521
Target Start/End: Complemental strand, 20374 - 20053
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||| ||||||||| ||||||||| ||||| ||    
T  20374 catttgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatgatggaaagaagggatgctgagagtatggc 20275  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20274 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 20175  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||    
T  20174 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaacacaataatgccttctctgacagcttcttctaggcg 20075  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  20074 agtccccatggtgaccatctca 20053  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #2
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 20543 - 20393
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  20543 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 20444  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||| ||||| | |||||||||||| ||||| |||||||||||    
T  20443 cgggagtaactcagcatacaacattggtatcgggggaaaggtaggtctagc 20393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #3
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 30396 - 30095
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||| | ||  ||||||| ||||| ||||||     
T  30396 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcgcatatgggtatgacggag 30297  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  30296 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 30197  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||| | ||||||||  | ||||||||  |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  30196 accatacctcctcgatgcattcacagaggattcggctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 30097  T
Q  519 tc 520  Q
    ||    
T  30096 tc 30095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0124; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 38 - 85
Target Start/End: Complemental strand, 30579 - 30532
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgt 85  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||    
T  30579 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgt 30532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 238; Significance: 1e-131; HSPs: 63)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 200 - 509
Target Start/End: Complemental strand, 16041289 - 16040980
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||| ||  |||||||||||||||||| |||||||||  | |||||||||||||||||||||||||||||| ||||||||| ||||| ||    
T  16041289 catttgctgaacgacggaattaacgggtacctgaggttgacccgatgacaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 16041190  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16041189 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 16041090  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||    
T  16041089 tcttcttatgatgaccgttaccatacctctttgatgcatttacggaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacg 16040990  T
Q  500 agtccccatg 509  Q
    ||| ||||||    
T  16040989 agttcccatg 16040980  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 203 - 521
Target Start/End: Original strand, 16450178 - 16450496
Alignment:
Q  203 ttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgca 302  Q
    ||||| ||||| ||| |||| ||||||||||||| |||||||||| | ||||||||||||||| |||||||||||||| ||||||||| |||| |||||     
T  16450178 ttgctgaacgacggcattaatgggtacctgaggttgacccgatggcaaaggatactgatgataaaatggtggaaagaagggatgctgagagtactgcgcg 16450277  T
Q  303 tacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttct 402  Q
    |||||||||||||||  ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16450278 tacgggtacgacggaggtaactgggcagcattaataggggcaacagtagctatggattgaccggctccggcagataccatccctacttttgtttctttct 16450377  T
Q  403 tcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagt 502  Q
    |||||||||||||||||||||| || |||||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
T  16450378 tcttatgatgaccgttaccgtatctttttgatgcatttacagaggattcaactttctcgaatacaataatgccttctctgacagcttcttctagacgagt 16450477  T
Q  503 ccccatgatgtccatctca 521  Q
    ||||||| || ||||||||    
T  16450478 ccccatggtgaccatctca 16450496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 16518615 - 16518916
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||||||||||||| ||||  ||||||| ||||| ||||||     
T  16518615 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtatgacggag 16518714  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  16518715 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16518814  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||| | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  16518815 accatacctctttgatgcatttacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16518914  T
Q  519 tc 520  Q
    ||    
T  16518915 tc 16518916  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 154; E-Value: 2e-81
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 16503579 - 16503880
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||||||||||||| ||||  ||||||| ||||| ||||||     
T  16503579 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtatgacggag 16503678  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  16503679 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16503778  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  16503779 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16503878  T
Q  519 tc 520  Q
    ||    
T  16503879 tc 16503880  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 16449985 - 16450135
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| | |||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16449985 gatggaaatcacacttgaggtcagaacgaaacctgggaggcaaaggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 16450084  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  16450085 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 16450135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 16041479 - 16041329
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||| ||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  16041479 gatggaaatcacactttaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 16041380  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||||||||| | ||||||||||||||| || |||||||||||    
T  16041379 cgggagtaactcggcatacaacattggtatcggagggaaggtaggtctagc 16041329  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 2154517 - 2154216
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||| ||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  2154517 ttaacggatacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 2154418  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  2154417 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 2154318  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| ||  | || ||||  |||||||| |||||||| |||||| || |||||    
T  2154317 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgatttcatccctgacggcttcttccagacgagttcccatggtgaccatc 2154218  T
Q  519 tc 520  Q
    ||    
T  2154217 tc 2154216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 26484850 - 26484700
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  26484850 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 26484751  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  26484750 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 26484700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 5127936 - 5127635
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||||||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  5127936 ttaacgggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 5127837  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  5127836 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 5127737  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||| ||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  5127736 accatacctcttcgatgcattcacagaggactcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 5127637  T
Q  519 tc 520  Q
    ||    
T  5127636 tc 5127635  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 2108992 - 2109142
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  2108992 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 2109091  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| ||||||| |||||||||| ||||||| |||||||||||    
T  2109092 cgggagcaactcagcatatatcattggtatcagaggaaaggtaggtctagc 2109142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 2775515 - 2775365
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||    
T  2775515 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagt 2775416  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||  |||| |||||||||||||||||| ||||||| |||||||||||    
T  2775415 cgggagctactcagcatatagcattggtatcagaggaaaggtaggtctagc 2775365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 31088451 - 31088601
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  31088451 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 31088550  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  31088551 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 31088601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 39211010 - 39211160
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| ||||||| |||| ||||||||| ||||||||||||||||||||||||||||    
T  39211010 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaagcttcccctgtctgattgtgcagtgccctctgagaagtagagt 39211109  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  39211110 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 39211160  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 10917064 - 10917365
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||| ||||| |||||| |||||| ||| ||||||||||||||||| ||||| |||||||| ||||||||| | ||  || |||| ||||| |||| |     
T  10917064 ttaacaggtacttgaggttgacccggtggcagaggatactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacgaag 10917163  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  10917164 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 10917263  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| ||||||| || ||||| ||  | || || |  |||||||| |||||||| |||||| || |||||    
T  10917264 accatacctctttgatgcattcacagaggattcagctttctcaaacacaatgatttcatccctaacggcttcttccagacgagttcccatggtgaccatc 10917363  T
Q  519 tc 520  Q
    ||    
T  10917364 tc 10917365  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 94; E-Value: 1e-45
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 11424975 - 11425276
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||| | ||  ||  ||| ||||| ||||||     
T  11424975 ttaacgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggag 11425074  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  |||||  |||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  11425075 gcatttgggctacattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 11425174  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  11425175 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 11425274  T
Q  519 tc 520  Q
    ||    
T  11425275 tc 11425276  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 45733616 - 45733466
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  45733616 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 45733517  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
       |||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  45733516 taagagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 45733466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 83; E-Value: 4e-39
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 18540947 - 18540805
Alignment:
Q  18 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 117  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |    
T  18540947 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttcccctgtctgattgtgcagtgccctctgagaagtagagtcgggagca 18540848  T
Q  118 actcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||| |||||||||||||||||| |||||||||||||||||||    
T  18540847 actcagcatatagcattggtatcagaggaaaagtaggtctagc 18540805  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Original strand, 31088651 - 31088775
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  31088651 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 31088750  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  31088751 acgacggaggtagctgagcagcatt 31088775  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Complemental strand, 45733416 - 45733292
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  45733416 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 45733317  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  45733316 acgacggaggtagctgagcagcatt 45733292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 222 - 472
Target Start/End: Complemental strand, 45387284 - 45387034
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  45387284 acgggcacttgaggttgacccggtggcagagggtactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 45387185  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  45387184 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 45387085  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataat 472  Q
     |||||||| || ||| |||| || |||||| ||||||| || ||||||||    
T  45387084 atacctcttcgacgcacttgcagaagattcagctttctcaaacacaataat 45387034  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 5147542 - 5147840
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||| ||||  ||  ||| || || ||||||   |    
T  5147542 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatggatatgacggaggca 5147641  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||  ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  5147642 tttgagctgcattgataggagcaatggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 5147741  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| |||||||| || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  5147742 atacctcttcgatgcattcgcagaagattcagctttctcaaacacaatgatcccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5147840  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 16736662 - 16736960
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||| | ||  ||  ||| ||||| |||||| | |    
T  16736662 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 16736761  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  16736762 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 16736861  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  16736862 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 16736960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 16751716 - 16752014
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||| | ||  ||  ||| ||||| |||||| | |    
T  16751716 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 16751815  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  16751816 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 16751915  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  16751916 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 16752014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #24
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 17523473 - 17523175
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||| | ||  ||  ||| ||||| |||||| | |    
T  17523473 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 17523374  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  17523373 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 17523274  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  17523273 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17523175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #25
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 17529742 - 17530040
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||| | ||  ||  ||| ||||| |||||| | |    
T  17529742 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggagaca 17529841  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  17529842 tttgagctgcattgataggagcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 17529941  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     || ||||| || ||| | || || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  17529942 atatctcttcgacgcactcgcagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17530040  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #26
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 11424791 - 11424913
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||||||||||||||||||||| ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  11424791 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtgcaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 11424890  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  11424891 atcggagggaaagtaggtctagc 11424913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #27
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 330 - 520
Target Start/End: Complemental strand, 31124744 - 31124554
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||||| || ||||    
T  31124744 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattaccatatctct 31124645  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    | |||||||| || ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  31124644 tcgatgcattcgcagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 31124554  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #28
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 5128141 - 5127998
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| |||||||||||||||||||| ||||| |||||||||||||| || ||||||||  | |||| ||| || ||     
T  5128141 atcacatttgagatcagacctgaaccttggaggcaacggattaggtgggggcttaccctgtctggttgtacaatgccctctatggagtaaagttggaagc 5128042  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||| | ||| ||||||||||||||||||||||||||    
T  5128041 aactcagcatacaacatcggtatcggaggaaaagtaggtctagc 5127998  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #29
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 10916883 - 10917005
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  10916883 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 10916982  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  10916983 atcggagggaaagtaggtctagc 10917005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #30
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 222 - 460
Target Start/End: Complemental strand, 11441501 - 11441263
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||| ||||||   |    
T  11441501 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 11441402  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  11441401 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 11441302  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctc 460  Q
     || ||||| || |||||| | ||||||||| |||||||    
T  11441301 atatctcttcgacgcatttacagaggattcagctttctc 11441263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #31
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 16503395 - 16503517
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  16503395 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16503494  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  16503495 atcggagggaaagtaggtctagc 16503517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #32
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 16518431 - 16518553
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  16518431 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 16518530  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  16518531 atcggagggaaagtaggtctagc 16518553  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #33
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 330 - 520
Target Start/End: Original strand, 24592851 - 24593041
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  24592851 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 24592950  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    | || |||||| | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  24592951 tcgacgcatttacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 24593041  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #34
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 211 - 436
Target Start/End: Original strand, 4145314 - 4145539
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| |||||    
T  4145314 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 4145413  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| ||     
T  4145414 tgacggaggcatttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtgg 4145513  T
Q  411 tgaccgttaccgtacctctttgatgc 436  Q
    || || ||||| |||||||| |||||    
T  4145514 tgtccattaccatacctcttcgatgc 4145539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #35
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 5147334 - 5147477
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  5147334 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 5147433  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||||||||||||||||||    
T  5147434 aactcagcatataacatcggtatcggaggaaaagtaggtctagc 5147477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #36
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 9618484 - 9618345
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  9618484 gcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatatctct 9618385  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  9618384 tcgatgcactcacagaggattcagctttctcaaacacaat 9618345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #37
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 26275404 - 26275511
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||    
T  26275404 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctct 26275503  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  26275504 tcgatgca 26275511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #38
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 26435198 - 26434900
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||| ||||  ||  ||| ||||| ||||||   |    
T  26435198 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26435099  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||| | ||||| |||||||| |||||||| ||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  26435098 tttgagctgcactgataggagcaacagtggccatggactgaccggctcctgctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 26434999  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     || ||||| | |||| | |  || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  26434998 atatctcttcggtgcactcgtagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 26434900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #39
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 330 - 435
Target Start/End: Original strand, 26320179 - 26320284
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||    
T  26320179 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctct 26320278  T
Q  430 ttgatg 435  Q
    | ||||    
T  26320279 tcgatg 26320284  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #40
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Complemental strand, 3445127 - 3445020
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  3445127 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 3445028  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  3445027 tcgatgca 3445020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #41
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 2154701 - 2154579
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  2154701 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 2154602  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||| |||||||    
T  2154601 atcggagggaaagtatgtctagc 2154579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #42
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 16736454 - 16736597
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16736454 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16736553  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  16736554 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16736597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #43
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 16751508 - 16751651
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16751508 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 16751607  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  16751608 aactcagcatataacatcggtatcggagggaaagtaggcctagc 16751651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #44
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 17523681 - 17523538
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  17523681 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17523582  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  17523581 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17523538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #45
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 17529534 - 17529677
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||| ||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  17529534 atcacatttgagatcagacctgaaccttggaggtaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaagc 17529633  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  17529634 aactcagcatataacatcggtatcggagggaaagtaggcctagc 17529677  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #46
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 222 - 437
Target Start/End: Original strand, 26485946 - 26486161
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||| ||||  ||  ||| ||||| ||||||   |    
T  26485946 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26486045  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  26486046 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 26486145  T
Q  422 gtacctctttgatgca 437  Q
     |||||||| ||||||    
T  26486146 atacctcttcgatgca 26486161  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #47
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 4145138 - 4145260
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  4145138 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 4145237  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  4145238 atcggagggaaagtaggcctagc 4145260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #48
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 9618779 - 9618657
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9618779 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9618680  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  9618679 atcggagggaaagtaggcctagc 9618657  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #49
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 26275109 - 26275231
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26275109 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26275208  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  26275209 atcggagggaaagtaggcctagc 26275231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #50
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 26319884 - 26320006
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26319884 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26319983  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  26319984 atcggagggaaagtaggcctagc 26320006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #51
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 45387471 - 45387349
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  45387471 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 45387372  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  45387371 atcggagggaaagtaggcctagc 45387349  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #52
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 38 - 157
Target Start/End: Complemental strand, 3445434 - 3445315
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  3445434 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 3445335  T
Q  138 atcggaggaaaagtaggtct 157  Q
    || ||||||||||| |||||    
T  3445334 ataggaggaaaagttggtct 3445315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #53
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 26435406 - 26435263
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  26435406 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 26435307  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  26435306 agttctgcatacaacattggtataggaggaaaagttggtctagc 26435263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #54
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 222 - 469
Target Start/End: Original strand, 26538075 - 26538322
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| || || |||||||| || || ||||| ||||| ||||||||| ||||  ||  ||| ||||| ||||||   |    
T  26538075 acgggcacttgaggttgacccggtggcagggggtactgatggtaaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 26538174  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
T  26538175 tttgagctgcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 26538274  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  26538275 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 26538322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #55
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 469
Target Start/End: Original strand, 26670224 - 26670363
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  26670224 gcattgataggagcaacggtagctattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 26670323  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  26670324 tcgatgcactcacagaggattcagctttctcaaacacaat 26670363  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #56
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 31564709 - 31564816
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  31564709 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 31564808  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  31564809 tcgatgca 31564816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #57
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 26669929 - 26670051
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| || |||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26669929 gaaccttgggggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26670028  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  26670029 atcggagggaaagtaggcctagc 26670051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #58
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 31564405 - 31564526
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  31564405 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 31564504  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  31564505 ataggaggaaaagttggtctag 31564526  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #59
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 211 - 359
Target Start/End: Complemental strand, 5159474 - 5159326
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  | ||||| |||||    
T  5159474 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 5159375  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 359  Q
     |||||    ||||| |||||||| ||||| ||||||||||||||||||    
T  5159374 ggacgggggaaactgagcagcattgataggagcaacagtagccatggat 5159326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #60
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 38 - 157
Target Start/End: Original strand, 26537885 - 26538004
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || |  || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26537885 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgcacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26537984  T
Q  138 atcggaggaaaagtaggtct 157  Q
    || ||||||||||| |||||    
T  26537985 ataggaggaaaagttggtct 26538004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #61
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 38 - 151
Target Start/End: Complemental strand, 11441700 - 11441587
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || || || | |||||||    
T  11441700 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcgtacaacattggt 11441601  T
Q  138 atcggaggaaaagt 151  Q
    || |||||||||||    
T  11441600 ataggaggaaaagt 11441587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #62
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 31125048 - 31124927
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  31125048 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 31124949  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  31124948 ataggaggaaaagttggtctag 31124927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 5159667 - 5159525
Alignment:
Q  18 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 117  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  5159667 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 5159568  T
Q  118 actcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  5159567 gctctgcatacaacattggtataggaggaaaagttggtctagc 5159525  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 215; Significance: 1e-118; HSPs: 100)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 200 - 522
Target Start/End: Complemental strand, 23892177 - 23891855
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||||||| || ||||||||||||||| |||||||||| | |||||||||||||||||||| ||||||||||||||||||| ||||  ||    
T  23892177 catttgctgaacgatggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatgttggaaagaaaggatgctgagagtacggc 23892078  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||| ||||||||||||   |  ||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
T  23892077 gcatatgggtacgacggaggcatttgggcagcattaataggagcaacagtagccatggattgatcggctccggcagataccatccctacttctgtttctt 23891978  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    ||||||||||||| |||||||| |||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||    
T  23891977 tcttcttatgatgtccgttaccatacctctttgatgcattcacggaggattcaactttctcgaatacaataattccttctctgacagcttcttccagacg 23891878  T
Q  500 agtccccatgatgtccatctcat 522  Q
    |||||||||| || |||||||||    
T  23891877 agtccccatggtgaccatctcat 23891855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 200 - 521
Target Start/End: Complemental strand, 25199003 - 25198682
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||| |||||||||| ||||||||||| |||||||||| | |||||||||||||||||||||||||||||||||||||||| ||||  ||    
T  25199003 catttgctgaacgacggcgttaacgagtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtacggc 25198904  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
    ||||| ||||||||||||   || |||| |||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |    
T  25198903 gcatatgggtacgacggaggcaattgggaagcattaataggagcaacagtagccatggattgaccggctccggcggataccatccctacttctgtttcct 25198804  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    ||||||||||||| ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| |||||||||| ||||||||| ||| |    
T  25198803 tcttcttatgatgtccgttaccgtacctctttgatgcattcacggaggattcaactttctcgaatacaataattccttctctgacagcttcttccagatg 25198704  T
Q  500 agtccccatgatgtccatctca 521  Q
    |||||||||| || ||||||||    
T  25198703 agtccccatggtgaccatctca 25198682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 138; E-Value: 7e-72
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 24688367 - 24688668
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||||||||| |||||||||||||| ||| | ||  ||||||| ||||| ||||||     
T  24688367 ttaacgggtacttgaggttgacccggtggcagagggtactgatgatagaatggcggaaagaaaggatgttgagaatacggcgcatatgggtatgacggag 24688466  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || || ||    
T  24688467 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 24688566  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  24688567 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 24688666  T
Q  519 tc 520  Q
    ||    
T  24688667 tc 24688668  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 22888634 - 22888484
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  22888634 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaaatagagt 22888535  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||| ||||| | ||||||||||||||| || |||||||||||    
T  22888534 cgggagtaactcagcatacaacattggtatcggagggaaggtaggtctagc 22888484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 25199193 - 25199043
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||||||||| |||||| ||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25199193 gatggaaatcacacttgagatcagaacggaacctgggaggtaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 25199094  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||||||||| | |||||||||||||| ||| |||||||||||    
T  25199093 cgggagtaactcggcatacaacattggtatcggagaaaaggtaggtctagc 25199043  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 23752660 - 23752961
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  23752660 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 23752759  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  23752760 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 23752859  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  23752860 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 23752959  T
Q  519 tc 520  Q
    ||    
T  23752960 tc 23752961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 30934588 - 30934287
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||| | ||  || |||| ||||| ||||||     
T  30934588 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 30934489  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| |||||||||| ||||||||| |||||||||| ||| |||||||||||||| |||||||||||||| || || || ||    
T  30934488 gcatttgggctgcattgataggagcaacagtagtcatggattggccggctccggtagacaccatccctacttccgtttctttcttcttgtggtgtccatt 30934389  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
T  30934388 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 30934289  T
Q  519 tc 520  Q
    ||    
T  30934288 tc 30934287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 326 - 520
Target Start/End: Complemental strand, 24951955 - 24951761
Alignment:
Q  326 ggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtac 425  Q
    ||||||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||||| |||    
T  24951955 ggcagcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgttaccatac 24951856  T
Q  426 ctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    ||||||||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||||    
T  24951855 ctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatctc 24951761  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 23718198 - 23718500
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  23718198 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 23718297  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  23718298 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 23718397  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagctt-cttctagacgagtccccatgatgtccat 517  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||| |||| |||||||| |||||| || ||||    
T  23718398 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttccttccagacgagttcccatggtgaccat 23718497  T
Q  518 ctc 520  Q
    |||    
T  23718498 ctc 23718500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 11549306 - 11549005
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| |||||||||||||||||||||||  | ||  || |||| ||||| ||||||     
T  11549306 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggtggaaagaaaggatgctgtgaatacggcacatatgggtatgacggag 11549207  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  11549206 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 11549107  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  11549106 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 11549007  T
Q  519 tc 520  Q
    ||    
T  11549006 tc 11549005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 200 - 357
Target Start/End: Complemental strand, 22888444 - 22888287
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| ||||| ||| ||||||| |||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||| ||    
T  22888444 catttgctgaacgacggcattaacggttacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtatggc 22888345  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatgg 357  Q
    ||||| ||||||||||||  ||||||||||||||||||||||||||||||||||||||    
T  22888344 gcatatgggtacgacggaggtaactgggcagcattaataggggcaacagtagccatgg 22888287  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 23892370 - 23892220
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||| ||  ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  23892370 gatggaaatcacatttgaggtcggaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 23892271  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||| || ||||||||||| |  ||||||||||||||||| |||||||||||    
T  23892270 cggaagcaactcggcatacatgattggtatcggaggaaaggtaggtctagc 23892220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 13184646 - 13184796
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13184646 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13184745  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  13184746 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 13184796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 33877411 - 33877261
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33877411 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 33877312  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  33877311 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 33877261  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #15
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 33777439 - 33777138
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  33777439 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 33777340  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  || || ||||| ||||| ||||||||||||||||||||||| ||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  33777339 gcatttgagctgcattgataggagcaacagtagccatggattgaccagctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 33777240  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  33777239 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 33777140  T
Q  519 tc 520  Q
    ||    
T  33777139 tc 33777138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #16
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 219 - 519
Target Start/End: Original strand, 22999324 - 22999624
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| ||||||  || ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  22999324 ttaacgggtacttgaggttgacccggcggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 22999423  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  22999424 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 22999523  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  22999524 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctccagacgggttcccatggtgaccatc 22999623  T
Q  519 t 519  Q
    |    
T  22999624 t 22999624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #17
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 11325958 - 11325808
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  11325958 gatggaaatcacatttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 11325859  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  11325858 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 11325808  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #18
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 13440492 - 13440642
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13440492 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13440591  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| |  ||||||| |||||||||| ||||||| |||||||||||    
T  13440592 cgggagtaatttagcatataacattggtatcagaggaaaggtaggtctagc 13440642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #19
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 29889080 - 29889230
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||  ||||||||||  ||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||    
T  29889080 gatggaaatcacatatgaggtcagaccggaacctgggaggcaacggatcaggtggaggcttgccctgtctggtggtgcagtgccctctgagaagtagagt 29889179  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     ||||||| ||| ||||| | |||||||||| ||||||| |||||||||||    
T  29889180 tgggagtagctcagcatacaacattggtatcagaggaaaggtaggtctagc 29889230  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #20
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Original strand, 13184846 - 13184970
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  13184846 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13184945  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  13184946 acgacggaggtagctgagcagcatt 13184970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #21
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Original strand, 13440692 - 13440816
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  13440692 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13440791  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  13440792 acgacggaggtagctgagcagcatt 13440816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #22
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Complemental strand, 33877211 - 33877087
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  33877211 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 33877112  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  33877111 acgacggaggtagctgagcagcatt 33877087  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #23
Raw Score: 72; E-Value: 2e-32
Query Start/End: Original strand, 222 - 469
Target Start/End: Original strand, 9548756 - 9549003
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| |||||||| || ||||| |||||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  9548756 acgggtacttgaggttgacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 9548855  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      ||||| | ||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  9548856 tttgggctgtattgataggagcaacagtggccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 9548955  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     |||||||| |||||| |  | ||||||||| ||||||| || |||||    
T  9548956 atacctcttcgatgcactcacagaggattcagctttctcaaacacaat 9549003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #24
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 200 - 334
Target Start/End: Complemental strand, 11325768 - 11325634
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||| ||| ||||| ||| |||||||||||||||||| | ||| |||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||    
T  11325768 cattcgctgaacgacggcattaacgggtacctgaggttgtcccaatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 11325669  T
Q  300 gcatacgggtacgacggaaataactgggcagcatt 334  Q
    ||||||| ||||||||||  || ||| ||||||||    
T  11325668 gcatacgtgtacgacggaggtagctgagcagcatt 11325634  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #25
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 15658973 - 15659271
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| |||||||| || || || |||||||||||||||||| | ||  || |||| || || ||||||   |    
T  15658973 acgggcacttgaggttgacccggtggcagagggtactgatggtaaaacggcggaaagaaaggatgctgagaatacggcacatatggatatgacggaggca 15659072  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  15659073 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 15659172  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  15659173 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 15659271  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #26
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 460
Target Start/End: Complemental strand, 41674658 - 41674420
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| |||||||| || ||||| ||||||||||||||||||   ||  || |||| ||||| ||||||   |    
T  41674658 acgggtacttgaggtggacccggtggcagagggtactgatggtaaaatggcggaaagaaaggatgctgagcatacggcacatatgggtatgacggaggca 41674559  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      ||||| | ||| ||||| ||||||||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  41674558 tttgggctgtattgataggagcaacagtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 41674459  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctc 460  Q
     |||||||| || |||||  | ||||||||  |||||||    
T  41674458 atacctcttcgacgcattcacagaggattcggctttctc 41674420  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #27
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 23752455 - 23752598
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  23752455 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 23752554  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  23752555 aactcagcatataacatcggtatcggagggaaagtaggtctagc 23752598  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #28
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 222 - 469
Target Start/End: Complemental strand, 31431377 - 31431130
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |    
T  31431377 acgggtacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggca 31431278  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||||||||  |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  31431277 tttgagctgcattgataggagcaacagtagccacagattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattacc 31431178  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  31431177 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 31431130  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #29
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 255 - 469
Target Start/End: Complemental strand, 2510967 - 2510753
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| ||||| |||||||    
T  2510967 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacggtagcca 2510868  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    |||||||||||||||| || |||||||| || ||||| |||||||||||||| || || || ||||| ||||||||||||||| |  | ||||||||| |    
T  2510867 tggattgaccggctccagctgataccattcccacttccgtttctttcttcttgtggtgtccattaccatacctctttgatgcactcacagaggattcagc 2510768  T
Q  455 tttctcgaatacaat 469  Q
    |||||| || |||||    
T  2510767 tttctcaaacacaat 2510753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #30
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 222 - 436
Target Start/End: Original strand, 8665688 - 8665902
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||  ||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||  ||| ||||| | ||||   |    
T  8665688 acgggcacttgaggttgacccggtgacagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatggcggaggca 8665787  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  8665788 tttgagctgcattgataggagcaacagtagccattgattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 8665887  T
Q  422 gtacctctttgatgc 436  Q
     |||||||| |||||    
T  8665888 atacctcttcgatgc 8665902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #31
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 11549490 - 11549368
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  11549490 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 11549391  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  11549390 atcggagggaaagtaggtctagc 11549368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #32
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 23718014 - 23718136
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  23718014 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 23718113  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  23718114 atcggagggaaagtaggtctagc 23718136  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #33
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 30934769 - 30934647
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  30934769 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 30934670  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  30934669 atcggagggaaagtaggtctagc 30934647  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #34
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 330 - 508
Target Start/End: Original strand, 40473873 - 40474051
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| |||||||||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||| ||||    
T  40473873 gcattgataggggcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtatctct 40473972  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
    | || |||||  | ||||||||| ||||||| || ||||| || || || ||||  |||||||| ||||| || |||||    
T  40473973 tcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcttcaagacgggttcccat 40474051  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #35
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 9317292 - 9317153
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  9317292 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 9317193  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    |||||||| |  | ||||||||| ||||||| || |||||    
T  9317192 ttgatgcactcacagaggattcagctttctcaaacacaat 9317153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #36
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 222 - 469
Target Start/End: Complemental strand, 30168418 - 30168171
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |    
T  30168418 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggca 30168319  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| || || |||| |||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || |||||    
T  30168318 tttgagctgcattgatgggagcaatagtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattacc 30168219  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| |||||| |  | ||||||||| ||||||| || |||||    
T  30168218 atatctcttcgatgcactcacagaggattcagctttctcaaacacaat 30168171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #37
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 255 - 437
Target Start/End: Complemental strand, 24681353 - 24681171
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  24681353 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24681254  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  24681253 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 24681171  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #38
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 24688183 - 24688305
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| |  || |||    
T  24688183 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaatatcggt 24688282  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  24688283 atcggagggaaagtaggtctagc 24688305  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #39
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 255 - 437
Target Start/End: Complemental strand, 24723880 - 24723698
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| ||||| || ||||||||||||||| | ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||||||    
T  24723880 tactgatgataaaatggcgggaagaaaggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagtagcca 24723781  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  24723780 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 24723698  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #40
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 24970154 - 24970032
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  24970154 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 24970055  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  24970054 atcggagggaaagtaggtctagc 24970032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #41
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 43078198 - 43077900
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||||||||||   |    
T  43078198 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtacgacggaggca 43078099  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| |||||||||||||| | |||||||||||| |  || |||||||| ||||| |||||||||||||| || || || |||||    
T  43078098 tttgagctgcattgataggtgcaacagtagccatagcttgaccggctccagttgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 43077999  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     || ||||| || |||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  43077998 atatctcttcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcgagacgggttcccatggtgaccatctc 43077900  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #42
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 255 - 520
Target Start/End: Original strand, 18375658 - 18375923
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
T  18375658 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 18375757  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
T  18375758 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 18375857  T
Q  455 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  18375858 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 18375923  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #43
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 6874143 - 6874004
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  6874143 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 6874044  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    |||||||| |  | ||||||||| ||||||| || |||||    
T  6874043 ttgatgcactcacagaggattcagctttctcaaacacaat 6874004  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #44
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 330 - 437
Target Start/End: Complemental strand, 12131996 - 12131889
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||    
T  12131996 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctct 12131897  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  12131896 tcgatgca 12131889  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #45
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 222 - 469
Target Start/End: Original strand, 18500961 - 18501208
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||| ||||||   |    
T  18500961 acgggcacttgaggttgacccggtggcagagggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 18501060  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || |  ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  18501061 tttgagttgcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 18501160  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     || ||||| || |||||  | ||||||||| ||||||| || |||||    
T  18501161 atatctcttcgacgcattcacagaggattcagctttctcaaacacaat 18501208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #46
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 33777644 - 33777501
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| |||||||| ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || ||     
T  33777644 atcacatttgaggtcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagc 33777545  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  33777544 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 33777501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #47
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 37771320 - 37771427
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  37771320 gcattgataggtgcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 37771419  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  37771420 tcgatgca 37771427  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #48
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 2511187 - 2511065
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  2511187 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 2511088  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  2511087 atcggagggaaagtaggcctagc 2511065  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #49
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 3789475 - 3789177
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| ||||||||  | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  ||  ||| ||||| ||||||   |    
T  3789475 acgggcacctgaggctggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcatatatgggtatgacggaggca 3789376  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  3789375 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 3789276  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     || ||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  3789275 atatctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 3789177  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #50
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 330 - 520
Target Start/End: Complemental strand, 5637751 - 5637561
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  5637751 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 5637652  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    | |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  5637651 tcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 5637561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #51
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 8665501 - 8665623
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  8665501 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 8665600  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  8665601 atcggagggaaagtaggcctagc 8665623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #52
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 15758883 - 15759005
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  15758883 gaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 15758982  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  15758983 atcggagggaaagtaggcctagc 15759005  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #53
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 330 - 472
Target Start/End: Original strand, 15759178 - 15759320
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||| ||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  15759178 gcattgataggagcaacagtagccattgattgacctgctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctct 15759277  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataat 472  Q
    | || ||| |||| || |||||| ||||||| || ||||||||    
T  15759278 tcgacgcacttgcagaagattcagctttctcaaacacaataat 15759320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #54
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 219 - 317
Target Start/End: Complemental strand, 24969976 - 24969878
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacgga 317  Q
    |||||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||||||||||||| | ||  ||||||| ||||||||||||    
T  24969976 ttaacgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgggtacgacgga 24969878  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #55
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 342 - 520
Target Start/End: Complemental strand, 30151847 - 30151669
Alignment:
Q  342 gcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttg 441  Q
    |||||||||||||| |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |    
T  30151847 gcaacagtagccattgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcg 30151748  T
Q  442 cggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
      || |||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  30151747 tagaagattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 30151669  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #56
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 330 - 508
Target Start/End: Original strand, 37358976 - 37359154
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  37358976 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 37359075  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
    | |||||| | |  || |||||| ||||||| |||||||| || || |||||||  ||||| || ||||| || |||||    
T  37359076 tcgatgcactcgtagaagattcagctttctcaaatacaatgatcccatctctgactgcttcctcaagacgggttcccat 37359154  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #57
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 6874462 - 6874319
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  6874462 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 6874363  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    | ||| ||||||| ||| ||||||||||| |||||||| |||||    
T  6874362 agctcagcatataacatcggtatcggagggaaagtaggcctagc 6874319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #58
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 9548548 - 9548691
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||||||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  9548548 atcacacttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 9548647  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  9548648 aattcagcatataacatcggtatcggagggaaagtaggtctagc 9548691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #59
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 22999119 - 22999262
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||||||||| || ||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| ||| || ||     
T  22999119 atcacacttgagatcggacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagttggaagc 22999218  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  22999219 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 22999262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #60
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 26480233 - 26480094
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  26480233 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatatctct 26480134  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  26480133 tcgatgcactcacagaggattcagctttctcaaacacaat 26480094  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #61
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 31826740 - 31826847
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  31826740 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 31826839  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  31826840 tcgatgca 31826847  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #62
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 37671813 - 37671920
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  37671813 gcattgataggagcaacggtagccatagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 37671912  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  37671913 tcgatgca 37671920  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #63
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 37754809 - 37754670
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  37754809 gcattgataggtgcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 37754710  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || ||| |||| || |||||| ||||||| || |||||    
T  37754709 tcgacgcacttgcagaagattcagctttctcaaacacaat 37754670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #64
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 26480528 - 26480406
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  26480528 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 26480429  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  26480428 atcggagggaaagtaggcctagc 26480406  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #65
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 255 - 437
Target Start/End: Complemental strand, 33516272 - 33516090
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
T  33516272 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagccgcattgatgggagcaacggtagcca 33516173  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  33516172 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 33516090  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #66
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 255 - 469
Target Start/End: Complemental strand, 34616437 - 34616223
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||||||    
T  34616437 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggtgcaacagtagcca 34616338  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | | |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |  | ||||||||| |    
T  34616337 tagcttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatgcactcacagaggattcagc 34616238  T
Q  455 tttctcgaatacaat 469  Q
    |||||| || |||||    
T  34616237 tttctcaaacacaat 34616223  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #67
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 37671488 - 37671630
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || |||||||| |||||  | |||| ||| || ||     
T  37671488 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 37671587  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  37671588 aactcagcatacaacattggtataggaggaaaagttggtctag 37671630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #68
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 15658765 - 15658908
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  15658765 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 15658864  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||| ||||| ||||||||||||||    
T  15658865 aactcagcatataacatcggtattggagggaaagtaggtctagc 15658908  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #69
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 41674866 - 41674723
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  41674866 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 41674767  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    || || ||||||| ||| ||||||||||| ||||||||||||||    
T  41674766 aattcagcatataacatcggtatcggagggaaagtaggtctagc 41674723  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #70
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 5638046 - 5637924
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  5638046 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 5637947  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  5637946 atcggagggaaagtaggcctagc 5637924  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #71
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 9317587 - 9317465
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9317587 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9317488  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  9317487 atcggagggaaagtaggcctagc 9317465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #72
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 12132291 - 12132169
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  12132291 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 12132192  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  12132191 atcggagggaaagtaggcctagc 12132169  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #73
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 18500735 - 18500877
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
T  18500735 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctttggagtaaagttggaagc 18500834  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    ||||| ||||||| ||| ||||| ||||||||||| |||||||    
T  18500835 aactcagcatataacatcggtataggaggaaaagttggtctag 18500877  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #74
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 28649392 - 28649250
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || ||     
T  28649392 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagc 28649293  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  28649292 aactcagcatacaacattggtataggaggaaaagttggtctag 28649250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #75
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 30152154 - 30152032
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  30152154 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30152055  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  30152054 atcggagggaaagtaggcctagc 30152032  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #76
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 30168605 - 30168483
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  30168605 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 30168506  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  30168505 atcggagggaaagtaggcctagc 30168483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #77
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 255 - 437
Target Start/End: Original strand, 32599715 - 32599897
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||| ||    
T  32599715 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagtca 32599814  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    | |||||||||||||| || || |||||||| ||||| ||||| |||||||| || || || ||||| |||||||| ||||||    
T  32599815 ttgattgaccggctccagctgacaccatccccacttccgtttccttcttcttgtggtgtccattaccatacctcttcgatgca 32599897  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #78
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 34616654 - 34616532
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
T  34616654 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 34616555  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||||||||| ||||||||    
T  34616554 ataggaggaaaagttggtctagc 34616532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #79
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 38 - 151
Target Start/End: Complemental strand, 31431576 - 31431463
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  31431576 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 31431477  T
Q  138 atcggaggaaaagt 151  Q
    || |||||||||||    
T  31431476 ataggaggaaaagt 31431463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #80
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 469
Target Start/End: Original strand, 13325165 - 13325304
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||| ||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  13325165 gcattgataggagcaacggtagccattgattgaccagctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 13325264  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  13325265 tcgatgcactcacagaggattcagctttctcaaacacaat 13325304  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #81
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 38 - 157
Target Start/End: Original strand, 31826433 - 31826552
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||||||| || || |  || ||||| | |||||||    
T  31826433 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtagagttggaagaagttctgcatacaacattggt 31826532  T
Q  138 atcggaggaaaagtaggtct 157  Q
    || ||||||||||| |||||    
T  31826533 ataggaggaaaagttggtct 31826552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #82
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 18375438 - 18375560
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
T  18375438 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 18375537  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||||||||||||||||||    
T  18375538 ataggaggaaaagtaggtctagc 18375560  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #83
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 342 - 460
Target Start/End: Complemental strand, 28649055 - 28648937
Alignment:
Q  342 gcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttg 441  Q
    |||||||||||||| | |||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||      
T  28649055 gcaacagtagccatagcttgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattca 28648956  T
Q  442 cggaggattcaactttctc 460  Q
    | ||||||||| |||||||    
T  28648955 cagaggattcagctttctc 28648937  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #84
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 28959812 - 28959934
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  28959812 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 28959911  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||||||||| ||||||||    
T  28959912 ataggaggaaaagttggtctagc 28959934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #85
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 331 - 437
Target Start/End: Original strand, 28960120 - 28960226
Alignment:
Q  331 cattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctt 430  Q
    |||| ||||| |||||||||||| | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| ||||||||    
T  28960120 cattgataggtgcaacagtagccgttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctctt 28960219  T
Q  431 tgatgca 437  Q
     ||||||    
T  28960220 cgatgca 28960226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #86
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 330 - 460
Target Start/End: Original strand, 29967387 - 29967517
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||| || || || || ||||| || ||||    
T  29967387 gcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttctttttgtggtgtccattaccatatctct 29967486  T
Q  430 ttgatgcatttgcggaggattcaactttctc 460  Q
    | || |||||  | ||||||||| |||||||    
T  29967487 tcgacgcattcacagaggattcagctttctc 29967517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #87
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 330 - 460
Target Start/End: Complemental strand, 30029256 - 30029126
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| ||||||||||| || || || || ||||| || ||||    
T  30029256 gcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttctttttgtggtgtccattaccatatctct 30029157  T
Q  430 ttgatgcatttgcggaggattcaactttctc 460  Q
    | || |||||  | ||||||||| |||||||    
T  30029156 tcgacgcattcacagaggattcagctttctc 30029126  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #88
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 17 - 159
Target Start/End: Original strand, 37770992 - 37771134
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| ||| || ||     
T  37770992 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagttggaagc 37771091  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    ||||| ||||| | ||||||||| ||||||||||| |||||||    
T  37771092 aactcagcatacaacattggtataggaggaaaagttggtctag 37771134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #89
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 37358669 - 37358790
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  37358669 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttccgcatacaacattggt 37358768  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  37358769 ataggaggaaaagttggtctag 37358790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #90
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 17 - 160
Target Start/End: Original strand, 32599477 - 32599620
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  32599477 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 32599576  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||||||||| ||||||||||| ||||||||    
T  32599577 agttctgcatacaacattggtataggaggaaaagttggtctagc 32599620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #91
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 3789677 - 3789556
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || |  || ||||| | |||||||    
T  3789677 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 3789578  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  3789577 ataggaggaaaagttggtctag 3789556  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #92
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 37755116 - 37754995
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  37755116 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgacctctctggagtaaagttggaagcaactcagcatacaacattggt 37755017  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  37755016 ataggaggaaaagttggtctag 37754995  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #93
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 211 - 359
Target Start/End: Complemental strand, 33292488 - 33292340
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  | ||||| |||||    
T  33292488 cgatggcattgacagggacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggtgcataagggta 33292389  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggat 359  Q
     |||||    ||||| |||||||| ||||| |||||||||||| |||||    
T  33292388 ggacgggggaaactgagcagcattgataggagcaacagtagccttggat 33292340  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #94
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 43078409 - 43078269
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || || || ||||||||  | |||||||| || ||     
T  43078409 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtacaatgccctctctggagtagagttggaaga 43078310  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    |  || ||||| | ||||||||| ||||||||||| |||||    
T  43078309 agttctgcatacaacattggtataggaggaaaagttggtct 43078269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #95
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 18 - 160
Target Start/End: Complemental strand, 33292681 - 33292539
Alignment:
Q  18 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 117  Q
    |||||||| || |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  33292681 tcacacttaagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 33292582  T
Q  118 actcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  33292581 gctctgcatacaacattggtataggaggaaaagttggtctagc 33292539  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #96
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 33516492 - 33516370
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  33516492 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 33516393  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || |||||||||||||| |||||    
T  33516392 ataggaggaaaagtaggcctagc 33516370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Complemental strand, 24681554 - 24681457
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  24681554 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 24681457  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Complemental strand, 24724081 - 24723984
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  24724081 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 24723984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #99
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 60 - 157
Target Start/End: Original strand, 40473597 - 40473694
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  40473597 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatataacatcggtataggaggaaaagttggtct 40473694  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 18 - 159
Target Start/End: Original strand, 13324835 - 13324976
Alignment:
Q  18 tcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagta 117  Q
    ||||| ||||| |||||  ||||||| ||||| || || |  ||||||||||||||||| || || |||||||| |||||  | |||| ||| || || |    
T  13324835 tcacatttgagatcagagcggaaccttggaggtaaagggtccggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagaa 13324934  T
Q  118 actcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
      || ||||| | ||||||||| ||||||||||| |||||||    
T  13324935 gttctgcatacaacattggtataggaggaaaagttggtctag 13324976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 158; Significance: 8e-84; HSPs: 43)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 158; E-Value: 8e-84
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 16283392 - 16283091
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    |||| ||||||||||||| |||| | ||| | |||||||| |||||||||||| |||||||||||||||||| ||||  ||||||| ||||||||||||     
T  16283392 ttaatgggtacctgaggttgacctggtggcaaaggatactaatgatagaatggcggaaagaaaggatgctgagagtacggcgcatatgggtacgacggag 16283293  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  16283292 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 16283193  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||||||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  16283192 accatacctctttgatgcattcacagaggattcagctttctcgaatacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 16283093  T
Q  519 tc 520  Q
    ||    
T  16283092 tc 16283091  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 16277497 - 16277196
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  16277497 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 16277398  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  16277397 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 16277298  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
T  16277297 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 16277198  T
Q  519 tc 520  Q
    ||    
T  16277197 tc 16277196  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 19688041 - 19687740
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||| ||||||||||| |||||||||||||||||  | ||  ||||||| ||||| ||||||     
T  19688041 ttaacgggtacttgaggttgacccggtggcagagggtactggtgatagaatggcggaaagaaaggatgctgggaatacggcgcatatgggtatgacggag 19687942  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| || || || ||    
T  19687941 gcatttgggcagcattgataggagcaacagtagccatggattgaccggctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 19687842  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| ||||| || |||||| || |||||    
T  19687841 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgggttcccatggtgaccatc 19687742  T
Q  519 tc 520  Q
    ||    
T  19687741 tc 19687740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 200 - 521
Target Start/End: Original strand, 22081125 - 22081446
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  | | | |||||||| ||||| |||||||| ||||||||||||||| ||||||||    
T  22081125 catttgctgagcaatggcattgacgggtacctgaggttgacccggcgatggcggatactggtgataaaatggtgggaagaaaggatgctgagagtattgc 22081224  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
       ||| | |||| ||||  || ||| |||||||| || ||||||||||||||||||||||||| || ||||||||||||||||||||||||||| ||||    
T  22081225 atgtactgatacggcggaggtagctgagcagcattgatgggggcaacagtagccatggattgactggttccggcagataccatccctacttctgtctctt 22081324  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||| || || ||| || ||||||||||||| |||||||||  ||| || || ||||||||||| ||||||| ||| |||||||  ||    
T  22081325 tcttcttatgatgaccattgccatacttccttgatgcatttgcagaggattcacatttttcaaacacaataatgccatctctgacagcctcttctaagcg 22081424  T
Q  500 agtccccatgatgtccatctca 521  Q
     || |||||| || ||||||||    
T  22081425 ggttcccatggtgaccatctca 22081446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 2137531 - 2137832
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||  |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  2137531 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatgacggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 2137630  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  2137631 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 2137730  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || | ||| ||||  ||||| || ||||| || |||||| || |||||    
T  2137731 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattcattccctgacggcttcctccagacgggttcccatggtgaccatc 2137830  T
Q  519 tc 520  Q
    ||    
T  2137831 tc 2137832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 14557570 - 14557269
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||| ||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||| | ||  || |||| ||||| ||||||     
T  14557570 ttaacaggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 14557471  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| || |||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  14557470 gcatttgggctgcattgataggagcgacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 14557371  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  14557370 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 14557271  T
Q  519 tc 520  Q
    ||    
T  14557270 tc 14557269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 44563256 - 44563106
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  44563256 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 44563157  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  44563156 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 44563106  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 27609177 - 27609478
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||   | |||| ||||| ||||||     
T  27609177 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacgacacatatgggtatgacggag 27609276  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  27609277 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 27609376  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||  |||||||||| ||||| || || || ||||  ||||| || |||||||| |||||| || |||||    
T  27609377 accatacctctttgatgcattcacagaggattcggctttctcgaacacaatgattccatccctgacggcttcctccagacgagttcccatggtgaccatc 27609476  T
Q  519 tc 520  Q
    ||    
T  27609477 tc 27609478  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 9354777 - 9354627
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||| ||||||||    
T  9354777 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgaggagtagagt 9354678  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  9354677 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 9354627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 19659099 - 19659249
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| |||| | ||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  19659099 gatggaaatcacacttgaggtccgaacggaacttgggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagt 19659198  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  19659199 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 19659249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 92; E-Value: 2e-44
Query Start/End: Original strand, 10 - 157
Target Start/End: Original strand, 22080938 - 22081085
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||| |||||||||||||||||| ||||||| | |||    
T  22080938 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacgggttaggtggaggctttccctgcctggttgtgcagtgccctttgagaagcaaagt 22081037  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    |||||| | |||||| || |||||||||||||||||||| ||||||||    
T  22081038 cgggagcagctcggcgtacagcattggtatcggaggaaaggtaggtct 22081085  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 87; E-Value: 2e-41
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 33244820 - 33244670
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| | |||||| |||| | ||||||||||||||||||||||||||||||| ||||| |||||||||||||    
T  33244820 gatggaaatcacacttgaggtccgaacggaacttaggaggcgacgggtcaggtggaggcttgccctgtctggttgtgcagcgccctttgagaagtagagt 33244721  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| ||  |||||| |||||||||| ||||||| |||||||||||    
T  33244720 cgggagtaattcaacatataacattggtatcagaggaaaggtaggtctagc 33244670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 210 - 334
Target Start/End: Original strand, 19659299 - 19659423
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||    
T  19659299 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgggt 19659398  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  19659399 acgacggaggtagctgagcagcatt 19659423  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 219 - 334
Target Start/End: Complemental strand, 44563047 - 44562932
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||     
T  44563047 ttaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgcgcatacgggtacgacggag 44562948  T
Q  319 ataactgggcagcatt 334  Q
     || ||| ||||||||    
T  44562947 gtagctgagcagcatt 44562932  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Complemental strand, 9354577 - 9354453
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  9354577 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 9354478  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  9354477 acgacggaggtagctgagcagcatt 9354453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 18710526 - 18710228
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| ||||| ||||||   |    
T  18710526 acgggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggca 18710427  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || |||||    
T  18710426 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattacc 18710327  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  18710326 atacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 18710228  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 19674378 - 19674080
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| ||||| || |||||||| ||||| |||||||||||||||||| | ||  ||  ||| ||||| ||||||   |    
T  19674378 acgggcacttgaggttgacccggtggcagagggtattgatgataaaatggcggaaagaaaggatgctgagaatacggcatatatgggtatgacggaggca 19674279  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| |||||||||||||||| |||||| || || |||||||| || || |||||||||||||| ||||| || |||||    
T  19674278 tttgagctgcattgataggagcaacggtagccatggattgactggctccagctgacaccatccccacgtccgtttctttcttcttgtgatgtccattacc 19674179  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||| || ||| | || || |||||| |||||||||| |||||||| || || ||||  ||||| || ||||| || |||||| || |||||||    
T  19674178 atacctcttcgacgcactcgcagaagattcagctttctcgaacacaataattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 19674080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 16283604 - 16283454
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || |||||||| || |||| |||    
T  16283604 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctaaggagtaaagt 16283505  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||| || ||||| ||||| | ||| ||||||||||| || |||||||||||    
T  16283504 cggaagcaactcagcatacaacatcggtatcggagggaaggtaggtctagc 16283454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #19
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 228 - 469
Target Start/End: Complemental strand, 19286399 - 19286158
Alignment:
Q  228 acctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactggg 327  Q
    ||||||||| | |||| ||||| ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| ||||| ||||||   |  || |    
T  19286399 acctgaggttggcccggtggtaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggtatgacggaggcatttgag 19286300  T
Q  328 cagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacct 427  Q
    | ||||| ||||| |||||||| |||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||    
T  19286299 ctgcattgataggagcaacagtggccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacct 19286200  T
Q  428 ctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    ||| || ||| | || || |||||| ||||||| || |||||    
T  19286199 cttcgacgcactcgcagaagattcagctttctcaaacacaat 19286158  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #20
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 16277681 - 16277559
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||||||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  16277681 gaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 16277582  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  16277581 atcggagggaaagtaggtctagc 16277559  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #21
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 222 - 460
Target Start/End: Original strand, 31490025 - 31490263
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |    
T  31490025 acgggcacttgaggttgacccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggca 31490124  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| |||||||||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  31490125 tttgagctgcattgataggggcaacagtagccattgattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattacc 31490224  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctc 460  Q
     || ||||| || |||||  | ||||||||| |||||||    
T  31490225 atatctcttcgacgcattcacagaggattcagctttctc 31490263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #22
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 2137347 - 2137469
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  2137347 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 2137446  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  2137447 atcggagggaaagtaggtctagc 2137469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #23
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 19688225 - 19688103
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  19688225 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 19688126  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  19688125 atcggagggaaagtaggtctagc 19688103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #24
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 27608993 - 27609115
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  27608993 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 27609092  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  27609093 atcggagggaaagtaggtctagc 27609115  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #25
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 211 - 436
Target Start/End: Complemental strand, 31354475 - 31354250
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| |||||    
T  31354475 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 31354376  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  ||||| ||||| ||||| ||||| || |||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| ||     
T  31354375 tgacggaggcatttgggctgcattgataggagcaacggtggccatggattgaccggctccagctgataccatccccacttccgtttctttcttcttgtgg 31354276  T
Q  411 tgaccgttaccgtacctctttgatgc 436  Q
    || || ||||| |||||||| |||||    
T  31354275 tgtccattaccatacctcttcgatgc 31354250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #26
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 31354672 - 31354529
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| |||||||| |||| ||||||||||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  31354672 atcacatttgagatcagacctgaaccttggaggcaaaggatcaggtggaggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 31354573  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||||||| ||| ||||||||||| |||||||| |||||    
T  31354572 aactcggcatataacatcggtatcggagggaaagtaggcctagc 31354529  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #27
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 14557751 - 14557629
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| ||| |  |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| |||||||    
T  14557751 gaaccttggaggcaacggatcaggcgagggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacattggt 14557652  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  14557651 atcggagggaaagtaggtctagc 14557629  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #28
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 19208743 - 19208850
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||| |||    
T  19208743 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacttct 19208842  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  19208843 tcgatgca 19208850  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #29
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 342 - 469
Target Start/End: Original strand, 28362350 - 28362477
Alignment:
Q  342 gcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttg 441  Q
    ||||| ||||||||||||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| || ||||| |||||| |      
T  28362350 gcaacggtagccatggattgaccggctccagctgataccatccccacttcagtttctttcttcttgtggtgtccattaccatatctcttcgatgcactca 28362449  T
Q  442 cggaggattcaactttctcgaatacaat 469  Q
    | ||||||||| ||||||| || |||||    
T  28362450 cagaggattcagctttctcaaacacaat 28362477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #30
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 330 - 508
Target Start/End: Original strand, 3329902 - 3330080
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||  |||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  3329902 gcattgataggagcaacgatagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 3330001  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
    | || |||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || |||||||| |||||    
T  3330002 tcgacgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgagttcccat 3330080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #31
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 19208448 - 19208570
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  19208448 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 19208547  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  19208548 atcggagggaaagtaggcctagc 19208570  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #32
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 330 - 508
Target Start/End: Complemental strand, 29829145 - 29828967
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  29829145 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 29829046  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
    | || |||||  | ||||||||| ||||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
T  29829045 tcgacgcattcacagaggattcagctttctcaaacacaatgattccatctctgacggcttcctcaagacgggttcccat 29828967  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #33
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 31489838 - 31489960
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  31489838 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 31489937  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  31489938 atcggagggaaagtaggcctagc 31489960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #34
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 330 - 469
Target Start/End: Original strand, 19518526 - 19518665
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  19518526 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 19518625  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  19518626 tcgacgcattcacagaggattcagctttctcaaacacaat 19518665  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #35
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 19674589 - 19674446
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| || ||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  19674589 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggtttgccctgtctagttgtacaatgccctctctggagtaaagttggaagc 19674490  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| |||||||| |||||    
T  19674489 aactcagcatataacatcggtatcggagggaaagtaggcctagc 19674446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #36
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 28362043 - 28362165
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  28362043 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 28362142  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  28362143 atcggagggaaagtaggcctagc 28362165  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #37
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 460
Target Start/End: Complemental strand, 33258555 - 33258425
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  33258555 gcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgcccattaccatatctct 33258456  T
Q  430 ttgatgcatttgcggaggattcaactttctc 460  Q
    | || |||||  | ||||||||| |||||||    
T  33258455 tcgacgcattcacagaggattcagctttctc 33258425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #38
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 3329595 - 3329716
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  3329595 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 3329694  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  3329695 ataggaggaaaagttggtctag 3329716  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #39
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 18710734 - 18710591
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||||||||| |||||   |||||| ||||||| ||||| |||||  ||||| |||||||| ||||| || ||||||||  | |||| ||| || ||     
T  18710734 atcacacttgagatcagacctgaaccttggaggcagcggatcaggtgagggcttaccctgtctagttgtacaatgccctctttggagtaaagttggaagc 18710635  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||| | ||||||||| ||||||||||| ||||||||    
T  18710634 aactcagcatacaacattggtataggaggaaaagttggtctagc 18710591  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #40
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 330 - 520
Target Start/End: Original strand, 12093116 - 12093306
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||| ||||||||| ||||| |||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| || ||||    
T  12093116 gcattgataggagcaatagtagccatagattggccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatatctct 12093215  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    | |||||| | |  || |||||| ||||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
T  12093216 tcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 12093306  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #41
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 12092812 - 12092933
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  12092812 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttccgcatacaacattggt 12092911  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  12092912 ataggaggaaaagttggtctag 12092933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #42
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 19286610 - 19286468
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| ||||||||||| || ||||| || ||||||||  | |||| ||| || ||     
T  19286610 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgcctagttgtacaatgccctctttggagtaaagttggaaga 19286511  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  19286510 agctctgcatacaacataggtataggaggaaaagttggtctag 19286468  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #43
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 37 - 159
Target Start/End: Complemental strand, 29829450 - 29829328
Alignment:
Q  37 ggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattgg 136  Q
    ||||||| ||||||||||||| |||||| ||||| ||||||||||| || || ||||||||  | |||| ||| || || |  || || || | ||||||    
T  29829450 ggaaccttggaggcaacggatcaggtgggggcttaccctgtctggtggtacaatgccctctctggagtaaagttggaagaagttctgcgtacaacattgg 29829351  T
Q  137 tatcggaggaaaagtaggtctag 159  Q
    ||| ||||||||||| |||||||    
T  29829350 tataggaggaaaagttggtctag 29829328  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089 (Bit Score: 146; Significance: 1e-76; HSPs: 6)
Name: scaffold0089
Description:

Target: scaffold0089; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 29706 - 29405
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| | ||| ||||||||||||||||| |||||||||||||||||| | ||  |||||||||||||||| |||     
T  29706 ttaacgggtacttgaggttgacccggtggcaaagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatacgggtacgatggag 29607  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || |||||    
T  29606 gcatttgggcagcattaataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgtt 29507  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||| ||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||    
T  29506 accatacctctttgatgcattcacagaggattcagctttttcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatc 29407  T
Q  519 tc 520  Q
    ||    
T  29406 tc 29405  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #2
Raw Score: 131; E-Value: 1e-67
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 40385 - 40683
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||||||||||||| |||||| ||| | ||| |||||||||||||||||  ||||||||||||||||| | ||  ||||||| ||||||| ||||   |    
T  40385 acgggtacctgaggttgacccggtggcaaagggtactgatgatagaatggcagaaagaaaggatgctgagaatacggcgcatatgggtacggcggaggca 40484  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      ||||| ||||| ||||| ||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| || || ||||||||    
T  40485 tttgggctgcattgataggagcaacagtagccatggattgaccggctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccgttacc 40584  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||||    
T  40585 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatctc 40683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #3
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 47298 - 47599
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| || || ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| || |||     
T  47298 ttaacgggtacttgaggttgacccggtggcagggggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgatggag 47397  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||| | |||||||||||||||| |||||||||||| || || |||||||||| ||| |||||||||||||| || || || ||    
T  47398 gcatttgggctgcattgataagagcaacagtagccatgggttgaccggctccagctgacaccatccctatttccgtttctttcttcttgtggtgtccatt 47497  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  ||||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
T  47498 accatacctctttgatgcattcacggaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 47597  T
Q  519 tc 520  Q
    ||    
T  47598 tc 47599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #4
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 29890 - 29768
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  29890 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 29791  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  29790 atcggagggaaagtaggtctagc 29768  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #5
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 40198 - 40320
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    ||||||||| |||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  40198 gaacctggggggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 40297  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  40298 atcggagggaaagtaggtctagc 40320  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0089; HSP #6
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 47114 - 47236
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  47114 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatacaacatcggt 47213  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  47214 atcggagggaaagtaggtctagc 47236  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109 (Bit Score: 134; Significance: 2e-69; HSPs: 2)
Name: scaffold0109
Description:

Target: scaffold0109; HSP #1
Raw Score: 134; E-Value: 2e-69
Query Start/End: Original strand, 200 - 521
Target Start/End: Complemental strand, 21529 - 21208
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||||| | | ||||| || ||||||||||||||| ||||||  ||| | |||||||| |||||||||||||| ||||||||||||||| ||||||||    
T  21529 catttgctgagcaatggcattgacgggtacctgaggttgacccggcggtggtggatactggtgatagaatggtgggaagaaaggatgctgagagtattgc 21430  T
Q  300 gcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctt 399  Q
       ||| |||||| ||||  || ||| | |||||| || |||||||||||||||| |||||||| || ||||||||||||||||||||||||||| ||||    
T  21429 atgtactggtacggcggaggtagctgagaagcattgatgggggcaacagtagccacggattgactggttccggcagataccatccctacttctgtctctt 21330  T
Q  400 tcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacg 499  Q
    |||||||||||||||| ||||| ||| || ||||||||||||| ||||||||| ||||||| || |||||||| || ||||||| ||| |||||||  ||    
T  21329 tcttcttatgatgaccattaccatacttccttgatgcatttgcagaggattcacctttctcaaacacaataattccgtctctgacagcctcttctaagcg 21230  T
Q  500 agtccccatgatgtccatctca 521  Q
     || |||||| || ||||||||    
T  21229 ggttcccatggtgaccatctca 21208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0109; HSP #2
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 10 - 157
Target Start/End: Complemental strand, 21716 - 21569
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||| ||||||||||||||| ||||||||||||||||| | |||||||||||||||||||| |||||||||||||| ||| ||||||| | |||    
T  21716 gatggaaatcgcacttgaggtcagaacggaacctgggaggcaacaggttaggtggaggcttgccctgcctggttgtgcagtgtcctttgagaagcaaagt 21617  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    |||||| | |||||||||||||||||||||||||||||| ||||||||    
T  21616 cgggagcagctcggcatatagcattggtatcggaggaaaggtaggtct 21569  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143 (Bit Score: 126; Significance: 1e-64; HSPs: 2)
Name: scaffold0143
Description:

Target: scaffold0143; HSP #1
Raw Score: 126; E-Value: 1e-64
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 27235 - 26934
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||||||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  27235 ttaacgggtacttgaggttgacccggtggtagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 27136  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  27135 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 27036  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  27035 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 26936  T
Q  519 tc 520  Q
    ||    
T  26935 tc 26934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0143; HSP #2
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 27419 - 27297
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  27419 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactcagcatataacatcggt 27320  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  27319 atcggagggaaagtaggtctagc 27297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0558 (Bit Score: 123; Significance: 6e-63; HSPs: 1)
Name: scaffold0558
Description:

Target: scaffold0558; HSP #1
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 129 - 279
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||||||||||    
T  129 gatggaaatcacacttgaggtcagaacggaacctggaaggcaacggatcaggtggaggcttgccatgtctggttgagcagtgccctctgagaagtagagt 228  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  229 cgggagtaactcggcatatagcattggtatcggaggaaaggtaggtctagc 279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 123; Significance: 6e-63; HSPs: 88)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 213 - 521
Target Start/End: Complemental strand, 20160650 - 20160345
Alignment:
Q  213 atggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacg 312  Q
    ||||| |||||||||||||||||| |||||| |||||||||||||||||| || ||||||||| |||||||||| ||| |||| || ||| || |||| |    
T  20160650 atggcattaacgggtacctgaggttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatg 20160551  T
Q  313 acggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg 412  Q
      |||  ||| || | |||||||| ||||||||||||||||||||||||||||||    ||| || ||||||||||||||||||| ||||||||||||||    
T  20160550 gtggaggtaattgagtagcattaacaggggcaacagtagccatggattgaccggca---gcaaattccatccctacttctgtttccttcttcttatgatg 20160454  T
Q  413 accgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatg 512  Q
    ||||||||||||||| |||| |||  |  ||||||||||| |||| || || ||||| || ||||| |||| ||||||||||||||| || |||||| ||    
T  20160453 accgttaccgtacctttttggtgcgctcacggaggattcacctttatcaaacacaatgattccttccctgacagcttcttctagacgggttcccatggtg 20160354  T
Q  513 tccatctca 521  Q
     ||||||||    
T  20160353 accatctca 20160345  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 213 - 521
Target Start/End: Original strand, 22172181 - 22172486
Alignment:
Q  213 atggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacg 312  Q
    ||||| |||||||||||||||||| |||||| |||||||||||||||||| || ||||||||| |||||||||| ||| |||| || ||| || |||| |    
T  22172181 atggcattaacgggtacctgaggttgacccggtggtagaggatactgatggtaaaatggtggatagaaaggatgttgagagtaatgtgcaaacaggtatg 22172280  T
Q  313 acggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatg 412  Q
      |||  ||| || | |||||||| ||||||||||||||||||||||||||||||    ||| || ||||||||||||||||||| ||||||||||||||    
T  22172281 gtggaggtaattgagtagcattaacaggggcaacagtagccatggattgaccggca---gcaaattccatccctacttctgtttccttcttcttatgatg 22172377  T
Q  413 accgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatg 512  Q
    ||||||||||||||| |||| |||  |  ||||||||||| |||| || || ||||| || ||||| |||| ||||||||||||||| || |||||| ||    
T  22172378 accgttaccgtacctttttggtgcgctcacggaggattcacctttatcaaacacaatgattccttccctgacagcttcttctagacgggttcccatggtg 22172477  T
Q  513 tccatctca 521  Q
     ||||||||    
T  22172478 accatctca 22172486  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 13299207 - 13299508
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  13299207 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 13299306  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| |||||||||||||| || || || ||    
T  13299307 gcatttgggctgcattgataggagcaacagtagccatggattgaccagctccggcagacaccatccctacttccgtttctttcttcttgtggtgtccatt 13299406  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| || ||||||||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  13299407 accatatctctttgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 13299506  T
Q  519 tc 520  Q
    ||    
T  13299507 tc 13299508  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 122; E-Value: 2e-62
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 24863657 - 24863356
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| || ||| ||| || ||||||||| ||||||||||||||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  24863657 ttaacgggtacttggggttgactcggtggtagagggtactgatgatagaatggcggaaagaaaggatgctgagaatacggcgcatatgggtaggacggag 24863558  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| |||||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||| || || || ||    
T  24863557 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccggctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 24863458  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| | |||| || |||||    
T  24863457 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttctcatggtgaccatc 24863358  T
Q  519 tc 520  Q
    ||    
T  24863357 tc 24863356  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 118; E-Value: 6e-60
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 15424573 - 15424874
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  ||||||| ||||| ||||||     
T  15424573 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcgcatatgggtatgacggag 15424672  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  15424673 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 15424772  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | || |||||| |||||||||| ||||| || ||||| ||||  ||||| || |||||||| |||||| || |||||    
T  15424773 accatacctctttgatgcattcacagaagattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgagttcccatggtgaccatc 15424872  T
Q  519 tc 520  Q
    ||    
T  15424873 tc 15424874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 22935136 - 22935434
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||| ||||| ||| | ||  ||||||| ||||| ||||||   |    
T  22935136 acgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaagggatgttgagaatacggcgcatatgggtatgacggaggca 22935235  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      ||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| || |||||||||| ||| |||||||||||||| || || ||||||||    
T  22935236 tttgggctgcattgataggagcaacagtagtcatggattgaccggccccggctgacaccatccctatttccgtttctttcttcttgtggtgtccgttacc 22935335  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||||    
T  22935336 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatctc 22935434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 222 - 520
Target Start/End: Original strand, 23857581 - 23857879
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||||||||||||| |||||| ||| |  |||||||||||||||||||| |||||||| ||||| ||| | ||  ||||||| ||||| ||||||   |    
T  23857581 acgggtacctgaggttgacccggtggcaagggatactgatgatagaatggcggaaagaagggatgttgagaatacggcgcatatgggtatgacggaggca 23857680  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      ||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| || |||||||||| ||| |||||||||||||| || || ||||||||    
T  23857681 tttgggctgcattgataggagcaacagtagtcatggattgaccggccccggctgacaccatccctatttccgtttctttcttcttgtggtgtccgttacc 23857780  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  |||||||| |||||||| |||||| || |||||||    
T  23857781 atacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcttccagacgagttcccatggtgaccatctc 23857879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 26988941 - 26988640
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  26988941 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 26988842  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  26988841 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 26988742  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| |||||||| |||||| || |||||    
T  26988741 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgagttcccatggtgaccatc 26988642  T
Q  519 tc 520  Q
    ||    
T  26988641 tc 26988640  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 27000013 - 26999712
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  27000013 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 26999914  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||| ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  26999913 gcatttgggctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 26999814  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| ||||| || ||||| ||||  ||||| || ||||| || |||||| || |||||    
T  26999813 accatacctctttgatgcattcacagaggattcagctttctcgaacacaatgattccttccctgacggcttcctccagacgggttcccatggtgaccatc 26999714  T
Q  519 tc 520  Q
    ||    
T  26999713 tc 26999712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 22456978 - 22457128
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  22456978 gatggaaatcacacttgaggtaagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccttatgagaagtagagt 22457077  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||||||||| | |||||||||| ||||||| |||||||||||    
T  22457078 cgggagtaactcggcatacatcattggtatcagaggaaaggtaggtctagc 22457128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 111; E-Value: 9e-56
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 22477317 - 22477467
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | |||||||||||||    
T  22477317 gatggaaatcacacttgaggttagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccatatgagaagtagagt 22477416  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||||||||||||||| | |||||||||| ||||||| |||||||||||    
T  22477417 cgggagtaactcggcatacatcattggtatcagaggaaaggtaggtctagc 22477467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 27290414 - 27290564
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||| ||||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  27290414 gatggaaatcacacttgaggtcagaacggaacttgggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 27290513  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| ||||||| |||||||||| ||||||| |||||||||||    
T  27290514 cgggagcaactcagcatataacattggtatcagaggaaaggtaggtctagc 27290564  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #13
Raw Score: 103; E-Value: 5e-51
Query Start/End: Original strand, 219 - 469
Target Start/End: Original strand, 24304874 - 24305124
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||| ||||||||| | ||  || |||| ||||| ||||||     
T  24304874 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaagggatgctgagaatacggcacatatgggtatgacggag 24304973  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  ||||||||||| ||||| || |||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  24304974 gcatttgggcagcattgataggagcgacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 24305073  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    ||| |||||||||||||||||  | ||||||||| |||||||||| |||||    
T  24305074 accatacctctttgatgcattcacagaggattcagctttctcgaacacaat 24305124  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #14
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 8892354 - 8892504
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  8892354 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 8892453  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  8892454 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 8892504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #15
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 8903589 - 8903739
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  8903589 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 8903688  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  8903689 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 8903739  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #16
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 13522117 - 13522267
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  13522117 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 13522216  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  13522217 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 13522267  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #17
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 14143329 - 14143479
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  14143329 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 14143428  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  14143429 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 14143479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #18
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 26788096 - 26787946
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  26788096 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 26787997  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  26787996 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 26787946  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #19
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 27196469 - 27196319
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  27196469 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 27196370  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  27196369 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 27196319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #20
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 27252771 - 27252921
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||||||  ||||||||||||| ||||||| |||||||||||| ||||||||| ||| ||||||||||||||||||||||||    
T  27252771 gatggaaatcacatttgaggtcagaccggaacctgggaggtaacggatcaggtggaggcttcccctgtctgattgcgcagtgccctctgagaagtagagt 27252870  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |||||| ||||| |||||||||||||||||| ||||||| |||||||||||    
T  27252871 cgggagcaactcagcatatagcattggtatcagaggaaaggtaggtctagc 27252921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #21
Raw Score: 99; E-Value: 1e-48
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 33374300 - 33374450
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| ||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  33374300 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaggtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 33374399  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  33374400 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 33374450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #22
Raw Score: 98; E-Value: 5e-48
Query Start/End: Original strand, 219 - 520
Target Start/End: Complemental strand, 16749794 - 16749493
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  16749794 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 16749695  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
    | |  || || || || ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || ||    
T  16749694 acatttgagctgcgttgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccatt 16749595  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| |||||| |  | ||||||||| |||||||||| ||||| || || || ||||  ||||| || ||||| || |||||| || |||||    
T  16749594 accatacctcttcgatgcactcacagaggattcagctttctcgaacacaatgatcccatccctgacggcttcctccagacgggttcccatggtgaccatc 16749495  T
Q  519 tc 520  Q
    ||    
T  16749494 tc 16749493  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #23
Raw Score: 97; E-Value: 2e-47
Query Start/End: Original strand, 219 - 363
Target Start/End: Original strand, 22477529 - 22477673
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    |||||||||||||||||| |||||||||| | |||||||| ||||||||||||||||||||| ||||||||| |||| |||||||||||||||||| ||     
T  22477529 ttaacgggtacctgaggttgacccgatggcaaaggatactaatgatagaatggtggaaagaagggatgctgagagtactgcgcatacgggtacgacagag 22477628  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgac 363  Q
     ||| |||||||||||||| |||||||||||||||||||||||||    
T  22477629 gtaattgggcagcattaattggggcaacagtagccatggattgac 22477673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #24
Raw Score: 96; E-Value: 8e-47
Query Start/End: Original strand, 222 - 469
Target Start/End: Complemental strand, 26918317 - 26918070
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    |||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||   |    
T  26918317 acgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggaggca 26918218  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||||||||||||||||||||||||||| || || |||||||||||||| |||||||||||||| || || || |||||    
T  26918217 tttgagctgcattgataggagcaacagtagccatggattgaccggctccagctgacaccatccctacttccgtttctttcttcttgtggtgtccattacc 26918118  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
     |||||||| ||||||||  | ||||||||| |||||||||| |||||    
T  26918117 atacctcttcgatgcattcacagaggattcagctttctcgaacacaat 26918070  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #25
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 10 - 160
Target Start/End: Complemental strand, 28162809 - 28162659
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||| ||| ||||| |||||||| | |||| | ||||||||||||||||||||||||||||||||||| |||||||||||||    
T  28162809 gatggaaatcacacttgaggtccgaacggaacttgggaggcgatggatcaagtggaggcttgccctgtctggttgtgcagtgccctttgagaagtagagt 28162710  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||||||| || ||||||| |||||||||| ||||||| |||||||||||    
T  28162709 cgggagtaattcagcatataacattggtatcagaggaaaggtaggtctagc 28162659  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #26
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 12 - 159
Target Start/End: Complemental strand, 20160851 - 20160704
Alignment:
Q  12 tggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcg 111  Q
    |||| |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| |    
T  20160851 tggaaatcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttg 20160752  T
Q  112 ggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    |||||||||| ||||||| ||| |||||||||||||| ||||||||||    
T  20160751 ggagtaactcagcatataacatcggtatcggaggaaaggtaggtctag 20160704  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #27
Raw Score: 80; E-Value: 3e-37
Query Start/End: Original strand, 12 - 159
Target Start/End: Original strand, 22171980 - 22172127
Alignment:
Q  12 tggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcg 111  Q
    |||| |||||||||||| || |||  |||||||||||| ||||||| ||||||||||||||| || ||||||||||| ||||||||| |||||| ||| |    
T  22171980 tggaaatcacacttgagatcggaacagaacctgggaggtaacggatcaggtggaggcttgccttgcctggttgtgcaatgccctctgtgaagtaaagttg 22172079  T
Q  112 ggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    |||||||||| ||||||| ||| |||||||||||||| ||||||||||    
T  22172080 ggagtaactcagcatataacatcggtatcggaggaaaggtaggtctag 22172127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #28
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 200 - 334
Target Start/End: Complemental strand, 28162619 - 28162485
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||| ||| ||||| ||| |||||||||||||||||| | |||||||| | |||||||||||||||||||||||||||||||||||||||| ||||||||    
T  28162619 cattcgctgaacgacggcattaacgggtacctgaggttgtcccgatggcaaaggatactgatgatagaatggtggaaagaaaggatgctgagagtattgc 28162520  T
Q  300 gcatacgggtacgacggaaataactgggcagcatt 334  Q
    |||||||||||||| |||  || ||| ||||||||    
T  28162519 gcatacgggtacgatggaggtagctgagcagcatt 28162485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #29
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Original strand, 13522317 - 13522441
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  13522317 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 13522416  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  13522417 acgacggaggtagctgagcagcatt 13522441  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #30
Raw Score: 77; E-Value: 2e-35
Query Start/End: Original strand, 210 - 334
Target Start/End: Original strand, 33374500 - 33374624
Alignment:
Q  210 acgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggt 309  Q
    |||| ||| |||||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| ||    
T  33374500 acgacggcattaacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgcgcatacgtgt 33374599  T
Q  310 acgacggaaataactgggcagcatt 334  Q
    ||||||||  || ||| ||||||||    
T  33374600 acgacggaggtagctgagcagcatt 33374624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #31
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 200 - 334
Target Start/End: Original strand, 8892544 - 8892678
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | || |||||||||||| |||||||||||||| ||||||||| ||||||||    
T  8892544 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatataatggtggaaagaagggatgctgagagtattgc 8892643  T
Q  300 gcatacgggtacgacggaaataactgggcagcatt 334  Q
    ||||||| ||||||||||  || ||| ||||||||    
T  8892644 gcatacgtgtacgacggaggtagctgagcagcatt 8892678  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #32
Raw Score: 71; E-Value: 6e-32
Query Start/End: Original strand, 200 - 334
Target Start/End: Original strand, 8903779 - 8903913
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||| ||| ||||| ||| |||||||||||||||||| |||||||||| | || |||||||||||||||||||||||||||  |||||||| ||||||||    
T  8903779 cattcgctgaacgacggcattaacgggtacctgaggttgacccgatggcaaagaatactgatgatagaatggtggaaagaagagatgctgagagtattgc 8903878  T
Q  300 gcatacgggtacgacggaaataactgggcagcatt 334  Q
    ||||||| ||||||||||  || ||| ||||||||    
T  8903879 gcatacgtgtacgacggaggtagctgagcagcatt 8903913  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #33
Raw Score: 70; E-Value: 3e-31
Query Start/End: Original strand, 211 - 520
Target Start/End: Complemental strand, 29549426 - 29549117
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| ||||  || |||| |||||    
T  29549426 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagagtacggcacatatgggta 29549327  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| |||    
T  29549326 tgacggaggcatttgagctgcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtga 29549227  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 510  Q
    || || ||||| |||||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
T  29549226 tgtccattaccatacctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 29549127  T
Q  511 tgtccatctc 520  Q
    || |||||||    
T  29549126 tgaccatctc 29549117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #34
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 22934924 - 22935074
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||    
T  22934924 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagt 22935023  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||| || ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  22935024 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtctagc 22935074  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #35
Raw Score: 67; E-Value: 2e-29
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 23857369 - 23857519
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||| ||   |||||||||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||    
T  23857369 gatggaaatcacatttgaggtcggacctgaacctgggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagt 23857468  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||| || ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  23857469 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtctagc 23857519  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #36
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 10 - 157
Target Start/End: Original strand, 27272624 - 27272771
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| |||||| |||||||| ||   ||||||||||||| |||||| |||||| ||||| |||||||||||||| || ||||||||  | ||||||||    
T  27272624 gatggaaatcacatttgaggtcggacctgaacctgggaggcgacggatcaggtgggggcttaccctgtctggttgtacaatgccctctctggagtagagt 27272723  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||| || ||||| ||||||| ||| ||||||||||| |||||||||||    
T  27272724 cggaagcaactcagcatataacatcggtatcggagggaaagtaggtct 27272771  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #37
Raw Score: 62; E-Value: 1e-26
Query Start/End: Original strand, 211 - 520
Target Start/End: Complemental strand, 27044338 - 27044029
Alignment:
Q  211 cgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggta 310  Q
    ||||||| || || || ||||||||| | |||| ||| | ||| ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| |||||    
T  27044338 cgatggcattgacaggaacctgaggttggcccggtggcaaagggtactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggta 27044239  T
Q  311 cgacggaaataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatga 410  Q
     ||||||   |  ||||| ||||| ||||| ||||| ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| ||     
T  27044238 tgacggaggcatttgggctgcattgataggagcaacggtagccatggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtgg 27044139  T
Q  411 tgaccgttaccgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatga 510  Q
    || || ||||| || ||||| |||||| |  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || ||||||     
T  27044138 tgtccattaccatatctcttcgatgcactcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatgg 27044039  T
Q  511 tgtccatctc 520  Q
    || |||||||    
T  27044038 tgaccatctc 27044029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #38
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 26918525 - 26918382
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| |||||| ||     
T  26918525 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagc 26918426  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||| | ||| ||||||||||| ||||||||||||||    
T  26918425 aactcagcatacaacatcggtatcggagggaaagtaggtctagc 26918382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #39
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 222 - 520
Target Start/End: Complemental strand, 3696000 - 3695702
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||| || |||||| |||||| ||| || || ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||| ||||||   |    
T  3696000 acgggcacttgaggttgacccggtggcagggggtactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggca 3695901  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
      || || ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||    
T  3695900 tttgagctgcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattacc 3695801  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
     || ||||| ||||||||  | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  3695800 atatctcttcgatgcattcacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 3695702  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #40
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 13299023 - 13299145
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  13299023 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 13299122  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  13299123 atcggagggaaagtaggtctagc 13299145  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #41
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 24304690 - 24304812
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  24304690 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatataacatcggt 24304789  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  24304790 atcggagggaaagtaggtctagc 24304812  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #42
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 26989125 - 26989003
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || || |||||  | |||| |||||| || ||||| ||||||| ||| |||    
T  26989125 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgtcctctatggagtaaagtcggaagcaactcagcatataacatcggt 26989026  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  26989025 atcggagggaaagtaggtctagc 26989003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #43
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 16749999 - 16749856
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  16749999 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagttggaagc 16749900  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    ||||| ||||||| ||| ||||||||||| ||||||||||||||    
T  16749899 aactcagcatataacatcggtatcggagggaaagtaggtctagc 16749856  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #44
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 251 - 437
Target Start/End: Complemental strand, 4525197 - 4525011
Alignment:
Q  251 aggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagta 350  Q
    ||||||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||    
T  4525197 aggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggtgcaacagta 4525098  T
Q  351 gccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    ||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  4525097 gccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgca 4525011  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #45
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 15424389 - 15424511
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| |||||| || ||||| ||||| | ||| |||    
T  15424389 gaaccttggaggcaacggatcaggtgggggcttgccctgtctagttgtacaatgccctctatggagtaaagtcggaagcaactcagcatacaacatcggt 15424488  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  15424489 atcggagggaaagtaggtctagc 15424511  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #46
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 24863841 - 24863719
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  24863841 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 24863742  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  24863741 atcggagggaaagtaggtctagc 24863719  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #47
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 27000197 - 27000075
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||||||||| || ||||||||  | |||| ||| || || ||||| ||||| | ||| |||    
T  27000197 gaaccttggaggcaacggatcaggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagttggaagcaactcagcatacaacatcggt 27000098  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| ||||||||||||||    
T  27000097 atcggagggaaagtaggtctagc 27000075  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #48
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 255 - 520
Target Start/End: Complemental strand, 17025166 - 17024901
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |  ||||| ||||| ||||| |||||||||||||    
T  17025166 tactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgggctgcattgataggagcaacagtagcca 17025067  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | | |||||||||||| || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||| ||||||||  | ||||||||  |    
T  17025066 tagcttgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggattcggc 17024967  T
Q  455 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  17024966 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 17024901  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #49
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Complemental strand, 4757590 - 4757483
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| || ||||||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| |||||||    
T  4757590 gcattgataggagcgacagtagccattgattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctct 4757491  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  4757490 tcgatgca 4757483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #50
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 4772826 - 4772687
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| ||||||||||||||||| || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  4772826 gcattgataggagcaacggtagccatagattgaccggctccggctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 4772727  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  4772726 tcgatgcactcacagaggattcagctttctcaaacacaat 4772687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #51
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 27007541 - 27007402
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27007541 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27007442  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  27007441 tcgatgcactcacagaggattcagctttctcaaacacaat 27007402  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #52
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 27484946 - 27484807
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||| ||||    
T  27484946 gcattgataggagcaacggtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtatctct 27484847  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | |||||| |  | ||||||||| ||||||| || |||||    
T  27484846 tcgatgcactcacagaggattcagctttctcaaacacaat 27484807  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #53
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 330 - 437
Target Start/End: Complemental strand, 29572842 - 29572735
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||||||||| |    
T  29572842 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttt 29572743  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  29572742 tcgatgca 29572735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #54
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 255 - 469
Target Start/End: Complemental strand, 29501310 - 29501096
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||||||||||   |  || || ||||| ||||| ||||| |||||||    
T  29501310 tactgatgataaaacggtgggaagaatggatgctgagaatacggcatatatgggtacgacggaggcatttgagctgcattgataggagcaacggtagcca 29501211  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| || |||||  |  |||||||| |    
T  29501210 tggattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgacgcattcacaaaggattcagc 29501111  T
Q  455 tttctcgaatacaat 469  Q
    |||||| || |||||    
T  29501110 tttctcaaacacaat 29501096  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #55
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 255 - 437
Target Start/End: Original strand, 30558308 - 30558490
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |  || || ||||| || || ||||| |||||||    
T  30558308 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacggtagcca 30558407  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgca 437  Q
    |||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||    
T  30558408 tggattgaccggctccagctgacaccatccccacttcagtttctttcttcttgtggtgtccattaccatacctcttcgatgca 30558490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #56
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 4525410 - 4525289
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| |||||||| || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4525410 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtgcaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4525311  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  4525310 ataggaggaaaagttggtctag 4525289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #57
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 29549620 - 29549477
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || ||     
T  29549620 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaaga 29549521  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    | ||| ||||| | ||||||||| ||||||||||| ||||||||    
T  29549520 agctctgcatacaacattggtataggaggaaaagttggtctagc 29549477  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #58
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 330 - 469
Target Start/End: Original strand, 34463728 - 34463867
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||| ||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  34463728 gcattgataggagcaacagtagtcattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 34463827  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  34463828 tcgacgcattcacagaggattcagctttctcaaacacaat 34463867  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #59
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 520
Target Start/End: Original strand, 4546151 - 4546341
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||    
T  4546151 gcattgataggagcaacggtagccatagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctct 4546250  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    | |||||| | |  || |||||| ||||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
T  4546251 tcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 4546341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #60
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 460
Target Start/End: Original strand, 16944394 - 16944524
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  16944394 gcattgataggagcaacagtagccattgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 16944493  T
Q  430 ttgatgcatttgcggaggattcaactttctc 460  Q
    | || |||||  | ||||||||| |||||||    
T  16944494 tcgacgcattcacagaggattcagctttctc 16944524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #61
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 520
Target Start/End: Complemental strand, 28207271 - 28207081
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||    
T  28207271 gcattgataggagcaacggtagccatagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctct 28207172  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    | |||||| | |  || |||||| ||||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
T  28207171 tcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 28207081  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #62
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 4773130 - 4773009
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4773130 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4773031  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  4773030 ataggaggaaaagttggtctag 4773009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #63
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 255 - 436
Target Start/End: Original strand, 26777919 - 26778100
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||||||||||||| | ||  ||   || ||||| ||||||   |  ||||| | ||| ||||| |||||||||||||    
T  26777919 tactgatgataaaacggtgggaagaaaggatgctgagaatacggcatgtatgggtatgacggaggcatttgggctgtattgataggtgcaacagtagcca 26778018  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgc 436  Q
    | ||||| |||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| |||||||| |||||    
T  26778019 ttgattgcccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgc 26778100  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #64
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 38 - 157
Target Start/End: Complemental strand, 3696205 - 3696086
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||| ||| || || ||||| ||||| | |||||||    
T  3696205 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctctctggagtaaagttggaagcaactcagcatacaacattggt 3696106  T
Q  138 atcggaggaaaagtaggtct 157  Q
    || ||||||||||| |||||    
T  3696105 ataggaggaaaagttggtct 3696086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #65
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 27360377 - 27360484
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27360377 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27360476  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  27360477 tcgatgca 27360484  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #66
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 27450720 - 27450827
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  27450720 gcattgataggagcaacggtagccatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 27450819  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  27450820 tcgatgca 27450827  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #67
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 29573137 - 29573015
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| ||||| || || |||||||| |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  29573137 gaaccttggaggcaacggatcaggtgggggcttaccctgcctagtcgtgcagtgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 29573038  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||||||||| ||||||||    
T  29573037 ataggaggaaaagttggtctagc 29573015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #68
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 151
Target Start/End: Original strand, 4545847 - 4545960
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || ||||| ||||| | |||||||    
T  4545847 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagcaactcagcatacaacattggt 4545946  T
Q  138 atcggaggaaaagt 151  Q
    || |||||||||||    
T  4545947 ataggaggaaaagt 4545960  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #69
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 151
Target Start/End: Original strand, 4724206 - 4724319
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  4724206 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 4724305  T
Q  138 atcggaggaaaagt 151  Q
    || |||||||||||    
T  4724306 ataggaggaaaagt 4724319  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #70
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 4757888 - 4757767
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||| ||| || || ||||| ||||| | |||||||    
T  4757888 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtaaagttggaagcaactcagcatacaacattggt 4757789  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  4757788 ataggaggaaaagttggtctag 4757767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #71
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 151
Target Start/End: Complemental strand, 28207578 - 28207465
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  28207578 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 28207479  T
Q  138 atcggaggaaaagt 151  Q
    || |||||||||||    
T  28207478 ataggaggaaaagt 28207465  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #72
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 17 - 157
Target Start/End: Complemental strand, 16674284 - 16674144
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  16674284 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 16674185  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    | ||| ||||| | ||||||||| ||||||||||| |||||    
T  16674184 agctctgcatacaacattggtataggaggaaaagttggtct 16674144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #73
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 17 - 157
Target Start/End: Original strand, 34463397 - 34463537
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| || ||||| || |||||||| |||||  | |||| ||| || ||     
T  34463397 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggctttccttgtctagtcgtgcagtgtcctctctggagtaaagttggaagc 34463496  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtct 157  Q
    ||||| ||||||| ||| ||||| ||||||||||| |||||    
T  34463497 aactcagcatataacatcggtataggaggaaaagttggtct 34463537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #74
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 16673956 - 16673817
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| ||||| || |||||||||||||| || || ||||| || ||||| |||||||||||||| || || || ||||| || ||||    
T  16673956 gcattgataggagcaacggtagctattgattgaccggctccagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatatctct 16673857  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    | || |||||  | ||||||||| ||||||| || |||||    
T  16673856 tcgacgcattcacagaggattcagctttctcaaacacaat 16673817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #75
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 330 - 508
Target Start/End: Original strand, 4724510 - 4724688
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| ||||| |    
T  4724510 gcattgataggagcaacggtagccatagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccataccttt 4724609  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
    | |||||| | |  || |||||| ||||||| || ||||| || || |||||||  ||||| || ||||| || |||||    
T  4724610 tcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccat 4724688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 27007872 - 27007730
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| ||||| |||||||| || |||||||| |||||  | |||| ||| || ||     
T  27007872 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtgggggcttaccctgtctagtcgtgcagtgtcctctctggagtaaagttggaaga 27007773  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    |  || ||||| | ||||||||| ||||||||||| |||||||    
T  27007772 agttctgcatacaacattggtataggaggaaaagttggtctag 27007730  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 17 - 159
Target Start/End: Complemental strand, 27044532 - 27044390
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||| | |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || ||     
T  27044532 atcacatttgagatcagacctgaaccttggaggcaacgggtcaggtgggggcttgccctgtctagttgtacaatgccctctttggagtaaagttggaaga 27044433  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    | ||| ||||| | ||| ||||| ||||||||||| |||||||    
T  27044432 agctctgcatacaacataggtataggaggaaaagttggtctag 27044390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #78
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 336 - 437
Target Start/End: Original strand, 26116792 - 26116893
Alignment:
Q  336 ataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatg 435  Q
    ||||| ||||| ||||| || |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||| ||||    
T  26116792 ataggagcaacggtagctatagattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctcttcgatg 26116891  T
Q  436 ca 437  Q
    ||    
T  26116892 ca 26116893  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 27485253 - 27485132
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||| ||| || || |  || ||||| | |||||||    
T  27485253 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgtcctctctggagtaaagttggaagaagttctgcatacaacattggt 27485154  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  27485153 ataggaggaaaagttggtctag 27485132  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #80
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 26777687 - 26777809
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  |||||||| | ||| |||    
T  26777687 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttcggcatacaacatcggt 26777786  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||| || || ||||||||    
T  26777787 ataggagggaaggttggtctagc 26777809  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #81
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 222 - 508
Target Start/End: Original strand, 27629968 - 27630254
Alignment:
Q  222 acgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaata 321  Q
    ||||||||||||||| | || ||||| | |||||| ||||| || || ||||| ||||| ||||||||| | ||| | | | | ||||| |  |||  ||    
T  27629968 acgggtacctgaggtggtcctgatggcaaaggatattgatggtaaaacggtgggaagaatggatgctgagaatatggtgtacaggggtatggtggaggta 27630067  T
Q  322 actgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttacc 421  Q
     ||| ||| |||||| |||||| ||||||||| | || ||||| ||||| |  |||||||| || || |||||||| |||||||| || || || || ||    
T  27630068 gctgagcaacattaacaggggcgacagtagccgtagactgacctgctcccgaggataccattccaacctctgtttccttcttcttgtggtggccattgcc 27630167  T
Q  422 gtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
     |||||||| ||  || |||  || || ||| | ||||| |||||||| || || |||||||  || || |||||||||||||||||    
T  27630168 atacctcttcgacccacttgtagaagactcacccttctcaaatacaatgataccctctctgacggcctcctctagacgagtccccat 27630254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #82
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 30558088 - 30558210
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | ||||  || || || |  || ||||| | |||||||    
T  30558088 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtaaggttggaagaagttctgcatacaacattggt 30558187  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || |||||||||||||| |||||    
T  30558188 ataggaggaaaagtaggcctagc 30558210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #83
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 26116482 - 26116603
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| || || || || |||||  | |||| |||||| || |  || ||||| | ||| |||    
T  26116482 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgacctctctggagtaaagtcggaagaagttctgcatacaacatcggt 26116581  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  26116582 ataggaggaaaagttggtctag 26116603  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #84
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 27360064 - 27360185
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
T  27360064 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27360163  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  27360164 ataggaggaaaagttggtctag 27360185  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #85
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 38 - 159
Target Start/End: Original strand, 27450407 - 27450528
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | ||| |||    
T  27450407 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgtcctctctggagtagagttggaagaagttctgcatacaacatcggt 27450506  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||||||||| |||||||    
T  27450507 ataggaggaaaagttggtctag 27450528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #86
Raw Score: 34; E-Value: 0.0000000008
Query Start/End: Original strand, 38 - 159
Target Start/End: Complemental strand, 29501539 - 29501418
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || || |||||  | |||||||| || || |  || ||||| | |||||||    
T  29501539 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgacctctctggagtagagttggaagaagttctgcatacaacattggt 29501440  T
Q  138 atcggaggaaaagtaggtctag 159  Q
    || ||||| || || |||||||    
T  29501439 ataggagggaaggttggtctag 29501418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #87
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 60 - 159
Target Start/End: Complemental strand, 17025379 - 17025280
Alignment:
Q  60 ggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctag 159  Q
    ||||||||||||||||| || || |||||||| |||||  | |||||||| || || |  || ||||| | ||||||||| ||||||||||| |||||||    
T  17025379 ggtggaggcttgccctgcctagtcgtgcagtgtcctctctggagtagagttggaagaagttctgcatacaacattggtataggaggaaaagttggtctag 17025280  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #88
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 327 - 508
Target Start/End: Original strand, 27272947 - 27273128
Alignment:
Q  327 gcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacc 426  Q
    |||||||||| |||||| ||||||||  | |  ||||| ||||| |  |||||||| || || |||||||| |||||||| || || || || || ||||    
T  27272947 gcagcattaacaggggcgacagtagctgtagtctgacctgctccagaggataccattccaacctctgtttccttcttcttgtggtggccattgccatacc 27273046  T
Q  427 tctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccat 508  Q
    ||||  |  ||||||  || || ||| | ||||| |||||||| || ||||| ||||  ||||| |||||||||||||||||    
T  27273047 tcttcaacccatttgtagaagactcacccttctcaaatacaatgataccttccctgacggcttcctctagacgagtccccat 27273128  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260 (Bit Score: 115; Significance: 4e-58; HSPs: 2)
Name: scaffold0260
Description:

Target: scaffold0260; HSP #1
Raw Score: 115; E-Value: 4e-58
Query Start/End: Original strand, 10 - 160
Target Start/End: Original strand, 2759 - 2909
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagt 109  Q
    |||||| ||||||||||||||||||| ||||||| ||||| ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||    
T  2759 gatggaaatcacacttgaggtcagaacggaacctaggaggtaacggatcaggtggaggcttgccctgtctggttgtgtagtgccctctgagaagtagagt 2858  T
Q  110 cgggagtaactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
     ||||||| |||||||||||||||||||||||||||||| |||||||||||    
T  2859 tgggagtagctcggcatatagcattggtatcggaggaaaggtaggtctagc 2909  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0260; HSP #2
Raw Score: 75; E-Value: 3e-34
Query Start/End: Original strand, 200 - 334
Target Start/End: Original strand, 2949 - 3083
Alignment:
Q  200 catttgctaaacgatggcgttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgc 299  Q
    |||||| | ||||| ||| || ||||||||||||||| |||||||||| | |||||||||||||||||||||||||||||| ||||||||| ||||||||    
T  2949 catttgttgaacgacggcattgacgggtacctgaggttgacccgatggcaaaggatactgatgatagaatggtggaaagaagggatgctgagagtattgc 3048  T
Q  300 gcatacgggtacgacggaaataactgggcagcatt 334  Q
    || |||||||||||||||  || ||| ||||||||    
T  3049 gcgtacgggtacgacggaggtagctgagcagcatt 3083  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029 (Bit Score: 102; Significance: 2e-50; HSPs: 2)
Name: scaffold0029
Description:

Target: scaffold0029; HSP #1
Raw Score: 102; E-Value: 2e-50
Query Start/End: Original strand, 219 - 520
Target Start/End: Original strand, 443 - 744
Alignment:
Q  219 ttaacgggtacctgaggtagacccgatggtagaggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaa 318  Q
    ||||||||||| |||||| |||||| ||| ||||| ||||||||||| ||||| |||||||||||||||||| | ||  || |||| ||||| ||||||     
T  443 ttaacgggtacttgaggttgacccggtggcagagggtactgatgataaaatggcggaaagaaaggatgctgagaatacggcacatatgggtatgacggag 542  T
Q  319 ataactgggcagcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgtt 418  Q
      |  || || ||||| ||||| ||||||||||||||||||||||||||||| |  || |||||||||||||| |||||||||||||| || || || ||    
T  543 gcatttgagctgcattgataggagcaacagtagccatggattgaccggctccagttgacaccatccctacttccgtttctttcttcttgtggtgtccatt 642  T
Q  419 accgtacctctttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    ||| |||||||| ||||||||  | ||||||||| |||||||||| ||||| || || || ||||  |||||||| ||||| || |||||| || |||||    
T  643 accatacctcttcgatgcattcacagaggattcagctttctcgaacacaatgattccatccctgacggcttcttccagacgggttcccatggtgaccatc 742  T
Q  519 tc 520  Q
    ||    
T  743 tc 744  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0029; HSP #2
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 258 - 381
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaact-cggcatatagcattgg 136  Q
    |||| |||||||||||||||  ||||| |||||||||||||||||||| || ||||||||  | |||| |||||| || ||||   ||||||| ||| ||    
T  258 gaacttgggaggcaacggatccggtgggggcttgccctgtctggttgtacaatgccctctatggagtaaagtcggaagcaactaaagcatataacatcgg 357  T
Q  137 tatcggaggaaaagtaggtctagc 160  Q
    ||||||||| ||||||||||||||    
T  358 tatcggagggaaagtaggtctagc 381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415 (Bit Score: 74; Significance: 1e-33; HSPs: 3)
Name: scaffold0415
Description:

Target: scaffold0415; HSP #1
Raw Score: 74; E-Value: 1e-33
Query Start/End: Original strand, 10 - 95
Target Start/End: Original strand, 2018 - 2103
Alignment:
Q  10 gatggacatcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccct 95  Q
    |||||| ||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  2018 gatggaaatcacacttgaggtcagaacggaacctgggaggcaacggatcaggtggaggcttgccctgtctggttgtgcagtgccct 2103  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415; HSP #2
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 330 - 469
Target Start/End: Complemental strand, 5821 - 5682
Alignment:
Q  330 gcattaataggggcaacagtagccatg-gattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctc 428  Q
    ||||| ||||| ||||||||||||||  |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || |||    
T  5821 gcattgataggagcaacagtagccatttgattgaccggctccagctgacaccatccc-acttccgtttctttcttcttgtggtgtccattaccatatctc 5723  T
Q  429 tttgatgcatttgcggaggattcaactttctcgaatacaat 469  Q
    || || |||||  | ||||||||| ||||||| || |||||    
T  5722 ttcgacgcattcacagaggattcagctttctcaaacacaat 5682  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0415; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 17 - 97
Target Start/End: Complemental strand, 6160 - 6080
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctct 97  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||    
T  6160 atcacatttgagatcagacctgaaccttggaggcaacggatcaggtggtggcttgccctgtctagtcgtacaatgccctct 6080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336 (Bit Score: 66; Significance: 6e-29; HSPs: 2)
Name: scaffold0336
Description:

Target: scaffold0336; HSP #1
Raw Score: 66; E-Value: 6e-29
Query Start/End: Original strand, 251 - 520
Target Start/End: Complemental strand, 8143 - 7874
Alignment:
Q  251 aggatactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagta 350  Q
    ||||||||||||||| || ||||| ||||| ||||||||| | ||  ||  ||| ||||| ||||||   |  || || ||||| ||||| |||||||||    
T  8143 aggatactgatgataaaacggtgggaagaacggatgctgagaatacggcatatatgggtatgacggaggcatttgagctgcattgataggagcaacagta 8044  T
Q  351 gccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggatt 450  Q
    ||||  |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||| |||||||| ||||||||  | |||||||    
T  8043 gccacagattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccatacctcttcgatgcattcacagaggatt 7944  T
Q  451 caactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    || ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  7943 cagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 7874  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0336; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 17 - 160
Target Start/End: Complemental strand, 9714 - 9571
Alignment:
Q  17 atcacacttgaggtcagaatggaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagt 116  Q
    |||||| ||||| |||||   |||||| ||||||||||||| |||||| |||||||||||||| || || || ||||||||  | |||||||| || ||     
T  9714 atcacatttgagatcagatctgaaccttggaggcaacggatcaggtgggggcttgccctgtctagtcgtacaatgccctctctggagtagagttggaaga 9615  T
Q  117 aactcggcatatagcattggtatcggaggaaaagtaggtctagc 160  Q
    |  || ||||| | ||| ||||| ||||||||||| ||||||||    
T  9614 agttctgcatacaacataggtataggaggaaaagttggtctagc 9571  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0099 (Bit Score: 63; Significance: 4e-27; HSPs: 1)
Name: scaffold0099
Description:

Target: scaffold0099; HSP #1
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 326 - 520
Target Start/End: Original strand, 48568 - 48769
Alignment:
Q  326 ggcagcattaataggggcaacag-tagccatggattga--ccggctccggca-gataccatccc-tacttctgtttctttcttcttatgatgacc-gtta 419  Q
    ||||||||| ||||| ||||||| |||||||||||||   |||||||||||| || |||||||| |||||| |||||||||||||| || || || ||||    
T  48568 ggcagcattgataggagcaacaggtagccatggattggacccggctccggcaagacaccatcccctacttccgtttctttcttcttgtggtgtcccgtta 48667  T
Q  420 ccgtacctcttt-gatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatc 518  Q
    || ||||||||| ||||||||  | ||||||||| |||||||||| ||||| || ||||||||||  |||||||| |||||||| |||||| || |||||    
T  48668 ccatacctcttttgatgcattcacagaggattcagctttctcgaacacaatgattccttctctgacggcttcttccagacgagttcccatggtgaccatc 48767  T
Q  519 tc 520  Q
    ||    
T  48768 tc 48769  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144 (Bit Score: 59; Significance: 9e-25; HSPs: 2)
Name: scaffold0144
Description:

Target: scaffold0144; HSP #1
Raw Score: 59; E-Value: 9e-25
Query Start/End: Original strand, 330 - 520
Target Start/End: Original strand, 26626 - 26816
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  26626 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 26725  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    | || |||||| | ||||||||| ||||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  26726 tcgacgcatttacagaggattcagctttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 26816  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0144; HSP #2
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 45 - 160
Target Start/End: Original strand, 26338 - 26453
Alignment:
Q  45 ggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggtatcggag 144  Q
    ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||||||| || || | ||| ||||| | ||||||||| ||||    
T  26338 ggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtagagttggaagaagctctgcatacaacattggtataggag 26437  T
Q  145 gaaaagtaggtctagc 160  Q
    |||||||||| |||||    
T  26438 gaaaagtaggcctagc 26453  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237 (Bit Score: 58; Significance: 4e-24; HSPs: 2)
Name: scaffold0237
Description:

Target: scaffold0237; HSP #1
Raw Score: 58; E-Value: 4e-24
Query Start/End: Original strand, 255 - 520
Target Start/End: Original strand, 15279 - 15544
Alignment:
Q  255 tactgatgatagaatggtggaaagaaaggatgctgacagtattgcgcatacgggtacgacggaaataactgggcagcattaataggggcaacagtagcca 354  Q
    ||||||||||| || ||||| ||||| ||||||||| | ||| ||  ||| ||||| ||||||   |  || || ||||| || || |||||||||||||    
T  15279 tactgatgataaaacggtgggaagaacggatgctgagaatatggcatatatgggtatgacggaggcatttgagctgcattgatgggagcaacagtagcca 15378  T
Q  355 tggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctctttgatgcatttgcggaggattcaac 454  Q
    | |||||||||||||| || ||||||||||| ||||| |||||||||||||| || || || ||||||||||| || |||||| | |  || |||||| |    
T  15379 ttgattgaccggctccagctgataccatccccacttccgtttctttcttcttgtggtgtccattaccgtaccttttcgatgcactcgtagaagattcagc 15478  T
Q  455 tttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    |||||| || ||||| || || || ||||  ||||| || ||||| || |||||| || |||||||    
T  15479 tttctcaaacacaatgattccatccctgacggcttcctcaagacgggttcccatggtgaccatctc 15544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0237; HSP #2
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 15059 - 15181
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || |  || ||||| | |||||||    
T  15059 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagaagatctgcatacaacattggt 15158  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    || ||||||||||||||||||||    
T  15159 ataggaggaaaagtaggtctagc 15181  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350 (Bit Score: 56; Significance: 6e-23; HSPs: 2)
Name: scaffold0350
Description:

Target: scaffold0350; HSP #1
Raw Score: 56; E-Value: 6e-23
Query Start/End: Original strand, 330 - 437
Target Start/End: Original strand, 7663 - 7770
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| |||||||||||||| |||||||||||||| || || |||||||| ||||| |||||||||||||| || || || |||||||||||||    
T  7663 gcattgataggagcaacagtagccattgattgaccggctccagctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccgtacctct 7762  T
Q  430 ttgatgca 437  Q
    | ||||||    
T  7763 tcgatgca 7770  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0350; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 7368 - 7490
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| ||||| |||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  7368 gaaccttggaggcaacggatcaggtgggggcttaccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 7467  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  7468 atcggagggaaagtaggcctagc 7490  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159 (Bit Score: 51; Significance: 5e-20; HSPs: 3)
Name: scaffold0159
Description:

Target: scaffold0159; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Original strand, 9195 - 9317
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  9195 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 9294  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  9295 atcggagggaaagtaggcctagc 9317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #2
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 38 - 160
Target Start/End: Complemental strand, 20142 - 20020
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||||||||| ||||| || ||||||||  | |||| ||| || || ||||| ||||||| ||| |||    
T  20142 gaaccttggaggcaacggatcaggtggtggcttgccctgtctagttgtacaatgccctctctggagtaaagttggaagcaactcagcatataacatcggt 20043  T
Q  138 atcggaggaaaagtaggtctagc 160  Q
    |||||||| |||||||| |||||    
T  20042 atcggagggaaagtaggcctagc 20020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0159; HSP #3
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 330 - 433
Target Start/End: Original strand, 9490 - 9593
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| || || ||||||||||||||||||||||| || || |||||||| ||||| |||||||||||||| || || || ||||| || ||||    
T  9490 gcattgataggagcgacggtagccatggattgaccggctcccgctgacaccatccccacttccgtttctttcttcttgtggtgtccattaccatatctct 9589  T
Q  430 ttga 433  Q
    ||||    
T  9590 ttga 9593  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038 (Bit Score: 47; Significance: 1e-17; HSPs: 2)
Name: scaffold0038
Description:

Target: scaffold0038; HSP #1
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 330 - 520
Target Start/End: Complemental strand, 7769 - 7579
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctccggcagataccatccctacttctgtttctttcttcttatgatgaccgttaccgtacctct 429  Q
    ||||| ||||| ||||| |||||||| |||||||||||| | || || ||||| || ||||| |||||||||||||| || || || ||||| |||||||    
T  7769 gcattgataggagcaacggtagccatagattgaccggctgcagctgacaccattcccacttccgtttctttcttcttgtggtgtccattaccatacctct 7670  T
Q  430 ttgatgcatttgcggaggattcaactttctcgaatacaataatgccttctctgatagcttcttctagacgagtccccatgatgtccatctc 520  Q
    | |||||| | |  || |||||| ||||||| || ||||| || || |||||||  ||||| || ||||| || |||||| || |||||||    
T  7669 tcgatgcactcgtagaagattcagctttctcaaacacaatgatcccatctctgactgcttcctcaagacgggttcccatggtgaccatctc 7579  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0038; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 38 - 151
Target Start/End: Complemental strand, 8076 - 7963
Alignment:
Q  38 gaacctgggaggcaacggattaggtggaggcttgccctgtctggttgtgcagtgccctctgagaagtagagtcgggagtaactcggcatatagcattggt 137  Q
    |||||| ||||||||||||| |||||| |||||||| ||||| || || || ||||||||  | |||||||| || || ||||| ||||| | |||||||    
T  8076 gaaccttggaggcaacggatcaggtggtggcttgccttgtctagtcgtacaatgccctctctggagtagagttggaagcaactcagcatacaacattggt 7977  T
Q  138 atcggaggaaaagt 151  Q
    || |||||||||||    
T  7976 ataggaggaaaagt 7963  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0496 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0496
Description:

Target: scaffold0496; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 330 - 370
Target Start/End: Original strand, 157 - 197
Alignment:
Q  330 gcattaataggggcaacagtagccatggattgaccggctcc 370  Q
    ||||| ||||| |||||||||||||| ||||||||||||||    
T  157 gcattgataggtgcaacagtagccattgattgaccggctcc 197  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University