View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_low_22 (Length: 289)
Name: NF8841_low_22
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 260
Target Start/End: Complemental strand, 12416568 - 12416324
Alignment:
| Q |
12 |
gagatggacatcgcatccaatagttcttatgattatggtttcaaatccgagaatgtttcaaatgctaaccctacaactgtacggcagttggtgaaatttc |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
12416568 |
gagatggacatagcatccaatagttcttattcttatgatttcaaatccgagaatgtttcaaatgcttaccctacaactgtacagcagttggtgaaatttc |
12416469 |
T |
 |
| Q |
112 |
actattcagttatggcaaaaaaccaagtttctgaaagaattttacctacaattcctggaatatgaattgtctatgacttcacttttctgtgacctagttc |
211 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12416468 |
acttttcagctatggcaaaaaaccaagtttctgaaagaattttaactacaattcctggaatatgaattatctatgacttcacttttctgtgacctagttc |
12416369 |
T |
 |
| Q |
212 |
cttgctgaagacttgttttatatatgttggtagttatttttatttttgt |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12416368 |
cttgctgaagacttgttt----tatgttggtagttatttttatttttgt |
12416324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 12 - 260
Target Start/End: Complemental strand, 12428628 - 12428384
Alignment:
| Q |
12 |
gagatggacatcgcatccaatagttcttatgattatggtttcaaatccgagaatgtttcaaatgctaaccctacaactgtacggcagttggtgaaatttc |
111 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||| |||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
12428628 |
gagatggacatagcatccaatagttcttattcttatgatttcaaatccgagaatgtttcaaatgcttaccctacaactgtacagcagttggtgaaatttc |
12428529 |
T |
 |
| Q |
112 |
actattcagttatggcaaaaaaccaagtttctgaaagaattttacctacaattcctggaatatgaattgtctatgacttcacttttctgtgacctagttc |
211 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12428528 |
acttttcagctatggcaaaaaaccaagtttctgaaagaattttaactacaattcctggaatatgaattatctatgacttcacttttctgtgacctagttc |
12428429 |
T |
 |
| Q |
212 |
cttgctgaagacttgttttatatatgttggtagttatttttatttttgt |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
12428428 |
cttgctgaagacttgttt----tatgttggtagttatttttatttttgt |
12428384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University