View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_low_25 (Length: 282)
Name: NF8841_low_25
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 65 - 272
Target Start/End: Complemental strand, 38801472 - 38801265
Alignment:
| Q |
65 |
taccctattctcaacatgaaaagccatctcaatttgctcagggttgtgcaagacaccaccttcacccagctcttcgcgcataaagtccatttctactact |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38801472 |
taccctattctcaacatgaaaagccatctcaatttgctcagggttgtgcaagacaccaccttcacccagctcttcgcgcataaagtccatttctactact |
38801373 |
T |
 |
| Q |
165 |
ggtagattttgggcaagtacctcctcttcttccactctcatatcttgttccccagactgatttgaattgtcggcatgatgatcactttgagaggttcttt |
264 |
Q |
| |
|
||| |||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38801372 |
ggtggattttgggctagtacctcctcttcttctactctcatatcttgttccccagactgatttgaattgtcggcatgatgatcactttgagaggttcttt |
38801273 |
T |
 |
| Q |
265 |
ggtgatgt |
272 |
Q |
| |
|
|||||||| |
|
|
| T |
38801272 |
ggtgatgt |
38801265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 67 - 265
Target Start/End: Complemental strand, 38780293 - 38780092
Alignment:
| Q |
67 |
ccctattctcaacatgaaaagccatctcaatttgctcagggttgtgcaagacaccaccttcacccagctcttcgcgcataaagtccatttctact---ac |
163 |
Q |
| |
|
|||||||||||||| |||| ||| ||||||||||| ||||| |||||||||| || || || | ||| || ||||| ||||||||| || | || |
|
|
| T |
38780293 |
ccctattctcaacactgaaagtcatttcaatttgctctgggttctgcaagacacttccctctccaatctcctcacgcatcaagtccattcttagttccac |
38780194 |
T |
 |
| Q |
164 |
tggtagattttgggcaagtacctcctcttcttccactctcatatcttgttccccagactgatttgaattgtcggcatgatgatcactttgagaggttctt |
263 |
Q |
| |
|
| || ||||||||| | | ||||| |||||| || ||||||||| |||| | |||||||||| || || ||||||||||||| |||||| |||||| |
|
|
| T |
38780193 |
tagtgtattttgggctattgtctcctgttcttctacactcatatctcgttcaactaactgatttgagttatcagcatgatgatcaccttgagaagttctt |
38780094 |
T |
 |
| Q |
264 |
tg |
265 |
Q |
| |
|
|| |
|
|
| T |
38780093 |
tg |
38780092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University