View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8841_low_34 (Length: 241)

Name: NF8841_low_34
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8841_low_34
NF8841_low_34
[»] chr3 (1 HSPs)
chr3 (83-204)||(37396536-37396657)


Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 83 - 204
Target Start/End: Complemental strand, 37396657 - 37396536
Alignment:
83 gaggatacacttgaaagctttattattaagcaacaacgaaaaataagagaagaataccggctccaacgaggatgagaaccttggaggaggcaggtgccat 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
37396657 gaggatacacttgaaagctttattattaagcaacaacgaaaaataagagaagaataccggctccaacgaggatgagaaccttggaggaggcaggtgccat 37396558  T
183 ctgtaaggccatggttgttgtt 204  Q
    ||||||||||||||||||||||    
37396557 ctgtaaggccatggttgttgtt 37396536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University