View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_low_34 (Length: 241)
Name: NF8841_low_34
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_low_34 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 83 - 204
Target Start/End: Complemental strand, 37396657 - 37396536
Alignment:
| Q |
83 |
gaggatacacttgaaagctttattattaagcaacaacgaaaaataagagaagaataccggctccaacgaggatgagaaccttggaggaggcaggtgccat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37396657 |
gaggatacacttgaaagctttattattaagcaacaacgaaaaataagagaagaataccggctccaacgaggatgagaaccttggaggaggcaggtgccat |
37396558 |
T |
 |
| Q |
183 |
ctgtaaggccatggttgttgtt |
204 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37396557 |
ctgtaaggccatggttgttgtt |
37396536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University