View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8841_low_36 (Length: 229)
Name: NF8841_low_36
Description: NF8841
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8841_low_36 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 18189442 - 18189214
Alignment:
| Q |
1 |
tcatcttcttttttatcagatgtctctgcgagaaatttcaatacatcaaaaacattatacttctttttctcctcaaccctcccagattccaatccacttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189442 |
tcatcttcttttttatcagatgtctctgcgagaaatttcaatacatcaaaaacattatacttctttttctcctcaaccctcccagattccaatccacttg |
18189343 |
T |
 |
| Q |
101 |
cagtttctttctccgaaagacttcggattgagtctggcagcacacgcagcaacggatcctcatgcattccagaaccttctccgacctcacaacttgatct |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18189342 |
cagtttctttctccgaaagacttcggattgagtctggtagcacacgcagcaacggatcctcatgcattccagaaccttctccgacctcacaacttgatct |
18189243 |
T |
 |
| Q |
201 |
attcccctcaaccaagttaacattcccac |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||| |
|
|
| T |
18189242 |
attcccctcaaccaatttaacattcccac |
18189214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 164 - 228
Target Start/End: Complemental strand, 18189174 - 18189110
Alignment:
| Q |
164 |
gcattccagaaccttctccgacctcacaacttgatctattcccctcaaccaagttaacattccca |
228 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| | ||||||||| ||||||||||| |||| |
|
|
| T |
18189174 |
gcattccagaaccttctccgacctcacaaattgaattgttcccctcattcaagttaacatcccca |
18189110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University