View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8842_high_1 (Length: 314)
Name: NF8842_high_1
Description: NF8842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8842_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 284; Significance: 1e-159; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 299
Target Start/End: Original strand, 46899223 - 46899519
Alignment:
| Q |
1 |
caatggcagcatacagggagctgtccctttggggagacctgtgactttgctcatggagaagcaggtaatgttaactcatctgtttgttaatttccattct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46899223 |
caatggcagcatacagggagctgtccctttggggagacctgtgactttgctcatggagaagcaggtaatgttaactcatctgtttgttaatttccattct |
46899322 |
T |
|
| Q |
101 |
ccctattttgattaatggttttgattttaactttatcatataattctactgtttttgtgttcttgtatgatgattatgtagaaggttattttctctgatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
46899323 |
ccctattttgattaatggttttgattttaactttatcatataattctactgtttttgtgttcttctatgatgattatgtagaaggttattttctctgatg |
46899422 |
T |
|
| Q |
201 |
tatgatgtacaaattactgtgtttgaatgtgcgccactttcgttgttgtgtatgatattttcatggttggtttgacataaacttgtccctcctatttgt |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46899423 |
tatgatgtacaaattactgtgtttgaatgt--gccactttcgttgttgtgtatgatattttcatggttggtttgacataaacttgtccctcctatttgt |
46899519 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 4 - 129
Target Start/End: Original strand, 46864095 - 46864220
Alignment:
| Q |
4 |
tggcagcatacagggagctgtccctttggggagacctgtgactttgctcatggagaagcaggtaatgttaactcatctgtttgttaatttccattctccc |
103 |
Q |
| |
|
||||||||| |||||||||||||||||||||| |||| ||||| |||||||||||||||||||| |||||||||| | |||| |||||| || |||| |
|
|
| T |
46864095 |
tggcagcatcaagggagctgtccctttggggaggactgtcacttttctcatggagaagcaggtaataataactcatctttgtgttgatttcccttttccc |
46864194 |
T |
|
| Q |
104 |
tattttgattaatggttttgatttta |
129 |
Q |
| |
|
| ||||||||| |||| ||| ||||| |
|
|
| T |
46864195 |
ttttttgattattggtcttggtttta |
46864220 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University