View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8843_low_4 (Length: 302)
Name: NF8843_low_4
Description: NF8843
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8843_low_4 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 291
Target Start/End: Complemental strand, 1060107 - 1059816
Alignment:
| Q |
1 |
ctaagaaaactcaaatgccatatcttggtcattcatagggaaattagctataaattctaatttattttgtaatccnnnnnnnn-tctgagatttcaaact |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1060107 |
ctaagaaaactcaaatgccatatcttggtcattcatagggaaattagctataaattctaatttattttgtaatccaaaaaaaaatctgagatttcaaact |
1060008 |
T |
 |
| Q |
100 |
atatgaccaccgtattttgtaaattttaaataaaatgtttctgctttctttttcttcccctcttctcgtccacatcaagaattctatcgcaatgtacaat |
199 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
1060007 |
atatgaccaccctattttgtaaattttaaataaaatgtttctgctttctttttcttcccctcttctcatccacagcaagaattctatcgcaatgtacaat |
1059908 |
T |
 |
| Q |
200 |
aaatacatgaaataaatgagatttatagttttatacccttagaagttacgaactgcggacctccctccaatggtaattaaggtgatgtccat |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1059907 |
aaatacatgaaataaatgagatttatagttttatacccttagaagttacgaactgcggacctccctccaatggtaattaaggtgatgtccat |
1059816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University