View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8844_high_4 (Length: 229)
Name: NF8844_high_4
Description: NF8844
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8844_high_4 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 96 - 207
Target Start/End: Original strand, 30923021 - 30923132
Alignment:
| Q |
96 |
gaagtttcaaattggtttcataccgttccaattttgtgaagacttttctcaagaattatagaaaccaagatgaaaacagtacaaacacaaccaacagccc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30923021 |
gaagtttcaaattggtttcataccgttccaattttgtgaagacttttctcaagaattatagaaaccaagatgaaaacagtacaaacacaaccaacagccc |
30923120 |
T |
|
| Q |
196 |
atgttggtgtct |
207 |
Q |
| |
|
|||||||||||| |
|
|
| T |
30923121 |
atgttggtgtct |
30923132 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 115 - 211
Target Start/End: Complemental strand, 9925274 - 9925178
Alignment:
| Q |
115 |
ataccgttccaattttgtgaagacttttctcaagaattatagaaaccaagatgaaaacagtacaaacacaaccaacagcccatgttggtgtctgatc |
211 |
Q |
| |
|
|||||||||| | |||||||||||| |||||||| ||| || | |||||||||||| || ||||| | ||||| ||||||||||||| ||||| |
|
|
| T |
9925274 |
ataccgttcctaatttgtgaagactcttctcaagggctatggatatcaagatgaaaacggtgcaaactgcagcaacaccccatgttggtgtttgatc |
9925178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University