View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8845_high_1 (Length: 332)
Name: NF8845_high_1
Description: NF8845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8845_high_1 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 16 - 150
Target Start/End: Complemental strand, 2827340 - 2827207
Alignment:
| Q |
16 |
acaggcatgttgggaatatagatatgatggtgggggctattaaattccttaagatgtggaacatgcatcggcaaaccttaggtacgtgggagggaaattt |
115 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2827340 |
acaggcatgttgggaatatagatctgatggtgggggctattaaattccttaagatgtg-aacatgcatcggcaaaccttaggtatgtgggagggaaattt |
2827242 |
T |
|
| Q |
116 |
gaattacaaagtagaatgttgactaagataagtaa |
150 |
Q |
| |
|
|||||||||||| ||||| |||||||||| ||||| |
|
|
| T |
2827241 |
gaattacaaagtggaatgctgactaagattagtaa |
2827207 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 251 - 316
Target Start/End: Complemental strand, 2827139 - 2827074
Alignment:
| Q |
251 |
gtcgttttcctcattaccacagtttcaaattgcggtaatgagctttctttctaacacatgacagat |
316 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
2827139 |
gtcgttttcctcgttaccacagtttcaaattgcggtaatgagctttctttctaacacatggcagat |
2827074 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 251 - 302
Target Start/End: Original strand, 377101 - 377152
Alignment:
| Q |
251 |
gtcgttttcctcattaccacagtttcaaattgcggtaatgagctttctttct |
302 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
377101 |
gtcgttttcctccttacagcagtttcaaattgcggtaatgagcttcctttct |
377152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 251 - 310
Target Start/End: Complemental strand, 377847 - 377788
Alignment:
| Q |
251 |
gtcgttttcctcattaccacagtttcaaattgcggtaatgagctttctttctaacacatg |
310 |
Q |
| |
|
||||||||||||||||| || ||||||||||| ||||||||||| |||||| ||||||| |
|
|
| T |
377847 |
gtcgttttcctcattactgcaatttcaaattgcagtaatgagcttcctttctgacacatg |
377788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University