View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8845_high_3 (Length: 246)
Name: NF8845_high_3
Description: NF8845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8845_high_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 2 - 219
Target Start/End: Complemental strand, 47083545 - 47083335
Alignment:
| Q |
2 |
aaacactagaatggtactactactctcaagtgcccttattgaattaatggtatgcctctgaagtctgaccccaaaactcaaaatcgagggtgctatactc |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47083545 |
aaacactagaatggtactactactctcaagtgcccttattgaattaatggtatgcctctgaagtctgaccccaaaactcaaaatcgagggtgctatactc |
47083446 |
T |
 |
| Q |
102 |
tcaagtgaagtggctatatccattatccaatatccaatccaatacacacgggttgacaatgttataaggtgagatcagagaagtagatgtattttcttct |
201 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47083445 |
tcaagtgaagtggctata-------tccaatatccaatccaatacacacgggttgacaatgttataaggtgagatcagagaagtagatgtattttcttct |
47083353 |
T |
 |
| Q |
202 |
gtgtcgttattgtaattg |
219 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
47083352 |
gtgtcgttattgtaattg |
47083335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University