View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8846_low_14 (Length: 241)
Name: NF8846_low_14
Description: NF8846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8846_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 17143614 - 17143392
Alignment:
| Q |
1 |
atcttggagacgttgagctttcttctttctctctttttcaaagtatcatcaactgcatctattccttgctggttagtttgtatctttcttatcactctca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
17143614 |
atcttggagacgttgagctttcttctttctctctttttcaaagtatcatcaactgcatctattccttgctggttagtttctatctttcttatcactctca |
17143515 |
T |
 |
| Q |
101 |
ttaatccaaagttttgtattatgtttatgtgggagctctaaagcatgggtacctataaaaaggtgaagtacctgtaaagggtactttacctgtatcgggt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17143514 |
ttaatccaaagttttgtattatgtttatgtgggagctctaaagcatgggtacctataaaaaggtgaagtacctgtaaagggtactttacctgtatcgggt |
17143415 |
T |
 |
| Q |
201 |
acgcgtagagtacttgtgattct |
223 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
17143414 |
acgcgtagagtacttgtggttct |
17143392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 17155785 - 17155676
Alignment:
| Q |
1 |
atcttggagacgttgagctttcttctttctctctttttcaaagtatcatcaactgcatctattccttgctggttagtttgtatctttcttatcactctca |
100 |
Q |
| |
|
|||||||||| |||| || |||||||||||||||||||||||| || |||| ||||||||||| ||||||||||||||||| || || |||||||| | |
|
|
| T |
17155785 |
atcttggagatattgaactctcttctttctctctttttcaaagtgtcctcaattgcatctattctttgctggttagtttgtactttcctcatcactctta |
17155686 |
T |
 |
| Q |
101 |
ttaatccaaa |
110 |
Q |
| |
|
|| ||||||| |
|
|
| T |
17155685 |
ttcatccaaa |
17155676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University