View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8846_low_4 (Length: 301)
Name: NF8846_low_4
Description: NF8846
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8846_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 218; Significance: 1e-120; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 282
Target Start/End: Complemental strand, 4081923 - 4081642
Alignment:
| Q |
1 |
gtggtgataattctattccagccatgagccaagagaattcttttgaaacttttgcaaaacctagtccaaagaattatcctgctagaattgcagttattgg |
100 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4081923 |
gtggtgatagttctattccagccatgagccaagagaattatttcgaaactttcgcaaaacctagtccaaagaattatcctgctagaattgcagttattgg |
4081824 |
T |
 |
| Q |
101 |
agatttgggactcacaagtaattctacaacaactattgatcatctgagttacaatgatccttcaatgattttaatgattggagatttaacttatgcaaat |
200 |
Q |
| |
|
|||||| || ||||||||||||||| ||||||| ||||||||||||||||||| ||||||||||||||| |||||||||| |||||||| ||||||||| |
|
|
| T |
4081823 |
agatttaggcctcacaagtaattcttcaacaacggttgatcatctgagttacaacgatccttcaatgattctaatgattggtgatttaacatatgcaaat |
4081724 |
T |
 |
| Q |
201 |
cagtatcttacaactggtggaaagggagcttcctgtttttcgtgtgcgtttccagatgcaccgatcagagagacctatcaac |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4081723 |
cagtatcttacaactggtggaaagggagcttcgtgcttttcgtgtgcgtttccagatgcaccgattagagagacctatcaac |
4081642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 116 - 162
Target Start/End: Complemental strand, 9578077 - 9578031
Alignment:
| Q |
116 |
aagtaattctacaacaactattgatcatctgagttacaatgatcctt |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||| | |||||||||||||| |
|
|
| T |
9578077 |
aagtaattctacaacaactattgaatatctaatttacaatgatcctt |
9578031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University