View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8847_low_3 (Length: 264)
Name: NF8847_low_3
Description: NF8847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8847_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 1 - 248
Target Start/End: Complemental strand, 50527105 - 50526858
Alignment:
| Q |
1 |
aagtgcttgtggtgtacttgctgtagtaatattgcaactttttcatttcactgtccctcaagctaggaagccagaattttggggtgtaccacttatgcca |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50527105 |
aagtgcctgtggtgtacttgctgtagtaatattgcaactttttcatttcactgtccctcaagctaggaagccagaattttggggtgtaccacttatgcca |
50527006 |
T |
 |
| Q |
101 |
tggataccagcaatttcaatctttttgaatttgtttttgctgggatcacttgatgggccatcctatgttagatttggagtcttttctgctgttgcagtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50527005 |
tggataccagcaatttcaatctttttgaatttgtttttgctgggatcacttgatgggccatcctatgttagatttggagtcttttctgctgttgcagtgc |
50526906 |
T |
 |
| Q |
201 |
tattctatattttctacagtgttcatgccagctttgatgctgaaggag |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50526905 |
tattctatattttctacagtgttcatgccagctttgatgctgaaggag |
50526858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University