View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8847_low_5 (Length: 247)
Name: NF8847_low_5
Description: NF8847
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8847_low_5 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 12 - 238
Target Start/End: Complemental strand, 34416381 - 34416155
Alignment:
| Q |
12 |
ggacatcaagaattgaacttgaactattaaactactatatgctgtggaccaaaacttggtaaagaagagtcgattattagttaatgaggcttgttggttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34416381 |
ggacatcaagaattgaacttgaactattaaactactatatgttgtggaccaaaacttggtaaagaagagtcgattattagttaatgaggcttgttggttt |
34416282 |
T |
|
| Q |
112 |
gttaatacttaaaagactaagatatatgttttttatttcaaagctataaaacaagttgtttgttcttatctagttcatactcattgttaaacaataatta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34416281 |
gttaatacttaaaagactaagatatatgttttttttttcaaagctataaaacaagttgtttgttcttatctagttcatactcattgttaaacaataatta |
34416182 |
T |
|
| Q |
212 |
actatattgaatgtttttggctctctg |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
34416181 |
actatattgaatgtttttggctctctg |
34416155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University