View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8849_high_3 (Length: 304)
Name: NF8849_high_3
Description: NF8849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8849_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 171; Significance: 8e-92; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 171; E-Value: 8e-92
Query Start/End: Original strand, 20 - 219
Target Start/End: Original strand, 43393912 - 43394113
Alignment:
| Q |
20 |
gatgaatcggcaatgccaccgtcgattccattcacgaccaacgagagagcttcgtaacaacaaatttttcgccgtcatcttagtttgagtggataaaggc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
43393912 |
gatgaatcggcaatgccaccgtcgattccatttacgaccaacgagagagcttcgtaacaacaaatttttcggcgtcatcttagtttgggtggataaaggc |
43394011 |
T |
 |
| Q |
120 |
tccataccgttgtagttcatttgcagcaagttccgacagtagtaatagaaaatataac--acccatttgcaattccatcatattattacttgggtgatgg |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43394012 |
tccataccgttgcagttcatttgcagcaagttccaacagtagtaatagaaaatataacaaacccatttgcaattccatcatattattacttgggtgatgg |
43394111 |
T |
 |
| Q |
218 |
ct |
219 |
Q |
| |
|
|| |
|
|
| T |
43394112 |
ct |
43394113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 79 - 174
Target Start/End: Complemental strand, 17547403 - 17547306
Alignment:
| Q |
79 |
acaaatttttcgccgtcatcttagtttgagtggataaaggctccataccgttgtagttcatttgcagcaagttccgacagtagta--atagaaaatat |
174 |
Q |
| |
|
|||||||| ||| | ||||||| |||| |||||||||||||||||||||| |||||||| ||| ||| ||||| |||||||| ||||||||||| |
|
|
| T |
17547403 |
acaaatttctcggcttcatcttggtttcagtggataaaggctccataccgccctagttcatctgcggcaggttccagcagtagtaggatagaaaatat |
17547306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University