View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8849_low_2 (Length: 311)
Name: NF8849_low_2
Description: NF8849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8849_low_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 22 - 306
Target Start/End: Complemental strand, 19992805 - 19992522
Alignment:
| Q |
22 |
agtccatctcgatttgggtttctattagagactatcaccacagtagcacacaaatcagtcacaactctttcacttcgnnnnnnngccgaatcggagattt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
19992805 |
agtccatctcgatttgggtttctattagagaccatcaccacagtagcacacaaatcagtcacaactctttcacttcgaaaaaa-gccgaatcggagattt |
19992707 |
T |
|
| Q |
122 |
tccgatctcctccgcaacgatgaaccggaaatgggaccggagagacaacaaggtttccaagaagcagaaactactcaacagcgccgaagaagaactcgaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19992706 |
tccgatctcctccgcaacgatgaaccggaaatgggaccggagagacaacaaggtttccaagaagcagaaattactcaacagcgccgaagaagaactcgaa |
19992607 |
T |
|
| Q |
222 |
gctaaattagggtttgatctcttctctgaaggtgaaaaacgactcggatggttactcactttttcatccgtaagttcatctcact |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
19992606 |
gctaaattagggtttgatctcttctctgaaggtgaaaaacgactcggatggttactcactttttcatccgtaagttcatttcact |
19992522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University