View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8849_low_4 (Length: 291)
Name: NF8849_low_4
Description: NF8849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8849_low_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 166; Significance: 7e-89; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 166; E-Value: 7e-89
Query Start/End: Original strand, 107 - 288
Target Start/End: Complemental strand, 38306892 - 38306711
Alignment:
| Q |
107 |
atcaaatatcacatctgttgcaattttaagctcaagccataacttctacccttcaaatggtaaattttggcattagaagtggtatttactctttcaatta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38306892 |
atcaaatatcacatctgttgcaattttaagctcaagccataacttctacccttcaaatggtaatttttggcattagaagaggtatttactctttcaatta |
38306793 |
T |
 |
| Q |
207 |
gacaacaattcatcatttattgagccaaaatcacaattttaaaaatacaatatatgcatgagcccgttcgaacaccaaactc |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
38306792 |
gacaacaattcatcatttattgagccaaaatcacaattttaaaaatacaatatatgcatgatcccgttcgaaccccaaactc |
38306711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 85 - 129
Target Start/End: Original strand, 312714 - 312758
Alignment:
| Q |
85 |
ttaaaatcgaactatttggtccatcaaatatcacatctgttgcaa |
129 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||| || ||||| |
|
|
| T |
312714 |
ttaaaatcgaactttttggtccttcaaatatcacatttggtgcaa |
312758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University