View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8850_high_10 (Length: 241)
Name: NF8850_high_10
Description: NF8850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8850_high_10 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 212; Significance: 1e-116; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 18 - 241
Target Start/End: Complemental strand, 8135945 - 8135722
Alignment:
| Q |
18 |
actatttacttaaaattccctcacttttatcctaaattatagaagcaattacaaactaatccctacctgcctctcttaatacattgcacgttaaaacact |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135945 |
actatttacttaaaattccctcacttttatcctaaattatacaagcaattacaaactaatccctacctgcctctcttaatacattgcacgttaaaacact |
8135846 |
T |
|
| Q |
118 |
tcgcaaaacccttcttagtttttccgaagtctcaacataaaacactagtcactttttgcaatcaatttttcttagtccacctttttctccagattttgtc |
217 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8135845 |
tcgcaaaacccttcttagttttttcgaagtctcaacataaaacactagtcactttttgcactcaatttttcttagtccacctttttctccagattttgtc |
8135746 |
T |
|
| Q |
218 |
gacctaaagttgtgaatcattttt |
241 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
8135745 |
gacctaaagttgtgaatcattttt |
8135722 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 18 - 103
Target Start/End: Complemental strand, 8134407 - 8134322
Alignment:
| Q |
18 |
actatttacttaaaattccctcacttttatcctaaattatagaagcaattacaaactaatccctacctgcctctcttaatacattg |
103 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||| |
|
|
| T |
8134407 |
actatttacttaaaattccatcacttttatcctaaattatagaagcaattagaaactaatccctacctgcctctcttaatatattg |
8134322 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University