View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8850_high_14 (Length: 208)
Name: NF8850_high_14
Description: NF8850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8850_high_14 |
 |  |
|
| [»] chr5 (4 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 88; Significance: 2e-42; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 121 - 208
Target Start/End: Original strand, 33681571 - 33681658
Alignment:
| Q |
121 |
tcactataaacttttccatttagaaaatgatatatgttgtgttgaggaaatacttttcaattcatcttatatttagaattattgcagt |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33681571 |
tcactataaacttttccatttagaaaatgatatatgttgtgttgaggaaatacttttcaattcatcttatatttagaattattgcagt |
33681658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 51 - 124
Target Start/End: Original strand, 33681436 - 33681509
Alignment:
| Q |
51 |
gtttttgcaattacttcaatagtaaaatttgtttcctggattactttatcattggaaatgttaatggagatcac |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33681436 |
gtttttgcaattacttcaatagtaaaatttgtttcctggattactttatcattggaaatgttaatggagatcac |
33681509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 127 - 190
Target Start/End: Original strand, 33666966 - 33667029
Alignment:
| Q |
127 |
taaacttttccatttagaaaatgatatatgttgtgttgaggaaatacttttcaattcatcttat |
190 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||| |||||||||||||| ||||||||||| |
|
|
| T |
33666966 |
taaacttttccatttagaaaatgatctatgctgtgttcaggaaatacttttctattcatcttat |
33667029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 51 - 100
Target Start/End: Original strand, 33666829 - 33666878
Alignment:
| Q |
51 |
gtttttgcaattacttcaatagtaaaatttgtttcctggattactttatc |
100 |
Q |
| |
|
||||||||||| |||||| ||||||| |||||||||||||||||| |||| |
|
|
| T |
33666829 |
gtttttgcaatcacttcattagtaaattttgtttcctggattactatatc |
33666878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University