View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8850_low_13 (Length: 241)

Name: NF8850_low_13
Description: NF8850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8850_low_13
NF8850_low_13
[»] chr5 (5 HSPs)
chr5 (19-232)||(22981461-22981677)
chr5 (74-234)||(22933677-22933833)
chr5 (74-231)||(21351314-21351467)
chr5 (105-229)||(21264735-21264859)
chr5 (105-199)||(21250900-21250994)
[»] scaffold0009 (3 HSPs)
scaffold0009 (105-229)||(22485-22609)
scaffold0009 (114-176)||(257379-257441)
scaffold0009 (115-194)||(214979-215058)
[»] scaffold0328 (1 HSPs)
scaffold0328 (105-194)||(9780-9869)


Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 232
Target Start/End: Complemental strand, 22981677 - 22981461
Alignment:
19 cataccatacatgcttgtattaataataattgaa---aactttatattgaattgagatattattgttcatattttaaatccttgatttagcagatattaa 115  Q
    ||||||||||||||||||||||||||| |||||    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
22981677 cataccatacatgcttgtattaataatgattgagttcaactttatattgaattgagatattattgttcatattttaaatccttgatttagcagatattaa 22981578  T
116 ccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagagaatatccattgctacatttcataggcttcaaatgagcagagt 215  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||    
22981577 ccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagaggatatccattgctacatttcataggcttcaaatgagcagtgt 22981478  T
216 tataggtccaacaccaa 232  Q
    |||||||||||||||||    
22981477 tataggtccaacaccaa 22981461  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 99; E-Value: 5e-49
Query Start/End: Original strand, 74 - 234
Target Start/End: Original strand, 22933677 - 22933833
Alignment:
74 attattgttcatattttaaatccttgatttagcagatattaaccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagag 173  Q
    ||||| ||||| |||||||||||||   ||| |||||||| || ||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||    
22933677 attatggttcacattttaaatcctt---tta-cagatatttacgaatggaatttaccgaagcattgagcatcgaggaatagtgaattcaaagaaggagag 22933772  T
174 aatatccattgctacatttcataggcttcaaatgagcagagttataggtccaacaccaaac 234  Q
     ||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||    
22933773 gatatccattgctacatttcataggcttaatatgagcagagttataggtccaacaccaaac 22933833  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 74 - 231
Target Start/End: Original strand, 21351314 - 21351467
Alignment:
74 attattgttcatattttaaatccttgatttagcagatattaaccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagag 173  Q
    |||||||||||| ||| ||||||||    | |||||||||||| || |||||||||||||||||||| ||| ||| |||| | ||||||| ||| |||||    
21351314 attattgttcatgtttaaaatcctt----ttgcagatattaactaacggaatttaccgaagcattgaacatcgagcaacaatcaattcaatgaatgagag 21351409  T
174 aatatccattgctacatttcataggcttcaaatgagcagagttataggtccaacacca 231  Q
     ||||| ||||||||||||||||||  ||||||||||| | || ||||||||||||||    
21351410 gatatcaattgctacatttcatagggctcaaatgagcaaaattctaggtccaacacca 21351467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 105 - 229
Target Start/End: Original strand, 21264735 - 21264859
Alignment:
105 gcagatattaaccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagagaatatccattgctacatttcataggcttcaa 204  Q
    ||||||| ||||||| ||| |||| |||||||| || ||| |||  || || || |||||||| ||||| || ||||||||  ||||||| || | ||||    
21264735 gcagatactaaccaacggagtttatcgaagcatcgaacatcgagctacggtgaactcaaagaaagagaggatttccattgcatcatttcacagacctcaa 21264834  T
205 atgagcagagttataggtccaacac 229  Q
    ||||||| |||||||||||||||||    
21264835 atgagcaaagttataggtccaacac 21264859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 105 - 199
Target Start/End: Original strand, 21250900 - 21250994
Alignment:
105 gcagatattaaccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagagaatatccattgctacatttcataggc 199  Q
    ||||||| |||| |||||||| |||||||||||||| ||| ||| |||||| |||||| | || || || || ||||||||| ||||||||||||    
21250900 gcagatagtaacaaatggaatataccgaagcattgaacatcgagcaacagttaattcagaaaaagaaaggatttccattgctgcatttcataggc 21250994  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009 (Bit Score: 45; Significance: 9e-17; HSPs: 3)
Name: scaffold0009
Description:

Target: scaffold0009; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 105 - 229
Target Start/End: Complemental strand, 22609 - 22485
Alignment:
105 gcagatattaaccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagagaatatccattgctacatttcataggcttcaa 204  Q
    ||||||||| || ||||||||||| ||||||||||| ||| |||  || || |||||| |||| | ||| || ||||||||| ||||||| || | |||     
22609 gcagatattgacaaatggaatttatcgaagcattgaacatcgagctacggttaattcagagaaagcgaggatttccattgctgcatttcacagacctcag 22510  T
205 atgagcagagttataggtccaacac 229  Q
    ||||||| |||||||||||||||||    
22509 atgagcaaagttataggtccaacac 22485  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 114 - 176
Target Start/End: Complemental strand, 257441 - 257379
Alignment:
114 aaccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagagaat 176  Q
    ||||||||||||||||||||||||||| ||| ||| |||||| |||||| |||||||||||||    
257441 aaccaatggaatttaccgaagcattgaacatcgagcaacagtgaattcagagaaggagagaat 257379  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0009; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 194
Target Start/End: Complemental strand, 215058 - 214979
Alignment:
115 accaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagagaatatccattgctacatttca 194  Q
    |||||||||||||||||||||||||| ||| ||| ||| || |||||  ||||||||||||| ||  ||||| |||||||    
215058 accaatggaatttaccgaagcattgaacatcgagcaacggtgaattcggagaaggagagaatctctgttgctgcatttca 214979  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0328 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0328
Description:

Target: scaffold0328; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 105 - 194
Target Start/End: Original strand, 9780 - 9869
Alignment:
105 gcagatattaaccaatggaatttaccgaagcattgagcatagaggaacagtaaattcaaagaaggagagaatatccattgctacatttca 194  Q
    ||||||||| ||||||||||||||| |||| ||||| ||| ||| |||||| ||||||  ||||||||| ||||| || |||||||||||    
9780 gcagatattgaccaatggaatttacagaagtattgaacatcgagcaacagtgaattcagtgaaggagaggatatctatggctacatttca 9869  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University