View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8850_low_14 (Length: 220)
Name: NF8850_low_14
Description: NF8850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8850_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 180; Significance: 2e-97; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 11 - 202
Target Start/End: Original strand, 36522886 - 36523077
Alignment:
| Q |
11 |
agcagagaaaatggcatacttggctccttttccttgagactcttacaaattacattataaaaatactgaaaaatcaaagaagttagtttaaacacaagga |
110 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36522886 |
agcaaagaaaatggcatacttggctccttttccttgagactcttacaaattacattataaaaatactgaaaaatcaaagaagttagtttaaacacaagga |
36522985 |
T |
 |
| Q |
111 |
gatcaaaataaaacaggttcttagttttctatatttacatgtccaatgtcatactaacttggcattattggaatattggcgatggaatggtt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
36522986 |
gatcaaaataaaacaggttcttagttttctatatttacatgtccaatgtcatactaactcggcattattggactattggcgatggaatggtt |
36523077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 115 - 154
Target Start/End: Original strand, 36529831 - 36529870
Alignment:
| Q |
115 |
aaaataaaacaggttcttagttttctatatttacatgtcc |
154 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
36529831 |
aaaataaaacaggttcttagttttgtacatttacatgtcc |
36529870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University