View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8850_low_8 (Length: 264)
Name: NF8850_low_8
Description: NF8850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8850_low_8 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 24 - 264
Target Start/End: Original strand, 18764069 - 18764309
Alignment:
| Q |
24 |
cagagaatgtgttaatcggttcagatgactacaaatgcattatggattcgtttgaatttaagatgaagtttgaatccactgaaagtgtcttgtacatgat |
123 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18764069 |
cagagaatgtgttaattggttcagatgactacaaatgcattatggattcgtttgaatttaagatgaagtttgaatcgactgaaagtgtcttgtacatgat |
18764168 |
T |
 |
| Q |
124 |
ttgaatcatttcaaaagtttcccaaacctttatgtttaggtagagacaattgaactacataaaataccaaacttaaaatcctgaccgcccaatgttgatc |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18764169 |
ttgaatcatttcaaaagtttcccaaacctttatgtttaggtagagacaattgaactacataaaataccaaacttaaaatcctgaccgcccaatgttgatc |
18764268 |
T |
 |
| Q |
224 |
tgacggccaagattcgtatgactgcacaaaatatgcatgcg |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18764269 |
tgacggccaagattcgtatgactgcacaaaatatgcatgcg |
18764309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University