View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8851_low_12 (Length: 283)
Name: NF8851_low_12
Description: NF8851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8851_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 23 - 260
Target Start/End: Complemental strand, 20618424 - 20618184
Alignment:
| Q |
23 |
tttgaagacatctggattttccctttgttgaagaaaccttgattttctaggaaaaccaggtcttgc-tggcgaacttaacatttcaaaacatctatataa |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
20618424 |
tttgaagacatctggattttccctttgttgaagaaaccttgattttctaggaaaaccaggtcttgcctagcgaacttaacatttcaaaacatctatataa |
20618325 |
T |
 |
| Q |
122 |
a--gagttgtaggtcattttagttgaacttgaccattgtaaacggaaccaaaatagagagacactgagagcatatagtatgagtcatcattgaagggcta |
219 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20618324 |
atagagttgtaggtcattttagttgaacttgaccattgtaaacggaaccaaaatagagagacactgagagcatatagtatgagtcatcattgaagggcta |
20618225 |
T |
 |
| Q |
220 |
ggaagattggaatcaatattggcaatgcttctccaacatct |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20618224 |
ggaagattggaatcaatattggcaatgcttctccaacatct |
20618184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University