View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8851_low_15 (Length: 249)
Name: NF8851_low_15
Description: NF8851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8851_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 238
Target Start/End: Complemental strand, 22797425 - 22797205
Alignment:
| Q |
16 |
catttatgagactaaattgcttaacccttaaaattt-cgaggatttacacgttaaaaatctaaagaaactagagaccaagcaagacnnnnnnncaatgga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22797425 |
catttatgagactaaattgcttaacccttaaaattttcaaggatttacacgttaaaaatctaaagaaactagagaccaagcaagacaaaa---caatgga |
22797329 |
T |
|
| Q |
115 |
agcaagcacaaatgtaaaataaatcatgttaaaacttttactatatatgttaatagaacattcttatattttgtagcagtagttcatgaatctttaatta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22797328 |
agcaagcacaaatgtaaaataaatcatgttaaaacttttactatatatgttaatagaacattcttatattttgtagcagtagttcatgaatctttaatta |
22797229 |
T |
|
| Q |
215 |
gttaatcactaaattgcaataaca |
238 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
22797228 |
gttaatcactaaattgcaataaca |
22797205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University