View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8851_low_16 (Length: 247)
Name: NF8851_low_16
Description: NF8851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8851_low_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 6138675 - 6138887
Alignment:
| Q |
19 |
acgacgctgctcttgcacgtgaaggaccaagtacttatggtactacttctgctacttggtctccactttatagtcctcctcgtggtacaataggtctttt |
118 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6138675 |
acgacgctgctcttgcacgtgcaggaccaagtacttatggtactacttctgctacttggtctccactttatagtcctcctcgtggtacaataggtctttt |
6138774 |
T |
 |
| Q |
119 |
tgaagatgatcgtccaattccatatcataatgcacctcattctgattttctcactgagcctctcgatattcctagcatgttacgtcgtcaagagcatcct |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6138775 |
tgaagatgatcgtccaattccatatcataatgcacctcattctgattttctcactgagcctctcgatattcctagcatgttatgtcgtcaagagcatcct |
6138874 |
T |
 |
| Q |
219 |
aggacaaacttca |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6138875 |
aggacaaacttca |
6138887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University