View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8851_low_19 (Length: 212)
Name: NF8851_low_19
Description: NF8851
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8851_low_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 8e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 8e-94
Query Start/End: Original strand, 13 - 194
Target Start/End: Original strand, 25408252 - 25408433
Alignment:
| Q |
13 |
gatgaattcggtcacatgctcgccgggatcttgaaagaaaacaacgtgagaggggatggtatcaactttgacaaaggcgctcgtactgcacttgcgtttg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25408252 |
gatgaattcggtcacatgctcgccgggatcttgaaagaaaacaacgtgagaggggatggtatcaactttgacaaaggcgctcgtactgcactcgcgtttg |
25408351 |
T |
|
| Q |
113 |
ttactctacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttcttactcctgaagatct |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25408352 |
ttactctacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgacatgcttcttactcctgaagatct |
25408433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 69; Significance: 4e-31; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 19 - 191
Target Start/End: Original strand, 42375231 - 42375403
Alignment:
| Q |
19 |
ttcggtcacatgctcgccgggatcttgaaagaaaacaacgtgagaggggatggtatcaactttgacaaaggcgctcgtactgcacttgcgtttgttactc |
118 |
Q |
| |
|
|||||||||||||| ||||||||||| || |||||| ||| | || ||||| | ||||||| |||| || |||||||| | ||||||||||||| |
|
|
| T |
42375231 |
ttcggtcacatgcttgccgggatcttaaaggaaaacggtgtggttgccgaaggtataacctttgaccaaggtgcacgtactgctttggcgtttgttactc |
42375330 |
T |
|
| Q |
119 |
tacgcgccgatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttcttactcctgaaga |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| |||||||| |||||||||| |||||||| |
|
|
| T |
42375331 |
tacgcgccgatggagagcgtgagtttatgttttatagaaatccaagtgctgacatgcttcttaaacctgaaga |
42375403 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 179
Target Start/End: Complemental strand, 46030717 - 46030665
Alignment:
| Q |
127 |
gatggagagcgtgagttcatgttttacagaaatccgagtgctgatatgcttct |
179 |
Q |
| |
|
||||| ||||| |||||| |||||| | ||||||| ||||||||||||||||| |
|
|
| T |
46030717 |
gatggcgagcgcgagttcttgtttttccgaaatcctagtgctgatatgcttct |
46030665 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University