View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8852_high_12 (Length: 220)
Name: NF8852_high_12
Description: NF8852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8852_high_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 206
Target Start/End: Complemental strand, 2137340 - 2137154
Alignment:
| Q |
20 |
caaaactggttctattagtgatcaatgatgctgccggtagtttacggctctataaaataaagttgttattgcatttactattaaatcaagctttacatag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2137340 |
caaaactggttctattagtgatcaatgatgctgcgggtagtttacggctctataaaataaaattgttattgcatttactattaaatcaagctttacatag |
2137241 |
T |
 |
| Q |
120 |
tgcattgaatcatgtttcagcaaatgtaatacaaccctaagaataacactaattaggattttcgttattttcttctattagtataat |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
2137240 |
tgcattgaatcatggttcagcaaatgtaacacaaccctgagaataacactaattaggattttcggtattttcttctattagtataat |
2137154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University