View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8852_high_6 (Length: 287)

Name: NF8852_high_6
Description: NF8852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8852_high_6
NF8852_high_6
[»] chr5 (1 HSPs)
chr5 (20-183)||(34451753-34451916)


Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 20 - 183
Target Start/End: Complemental strand, 34451916 - 34451753
Alignment:
20 gttcatggttgtaaatgttccacaatgcaagagagtggcggacatgatcatgtctgaagatcttcccctcatttgatgacttatcagtgaaattaggtga 119  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| |||||||||||||    
34451916 gttcatggttgtaaatgttccacaatgcaagagagtggcggacatgatcatgtctgaagatcttcccgtcacttgatgacttatcaatgaaattaggtga 34451817  T
120 ccgatatgtataaattggaatgtggagttgattacctaatatgatcatatttatattagaaata 183  Q
    ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
34451816 ccgatatgtataaattggaatgtggggttgattacctaatatgatcatatttatattagaaata 34451753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University