View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8852_low_11 (Length: 287)
Name: NF8852_low_11
Description: NF8852
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8852_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 20 - 183
Target Start/End: Complemental strand, 34451916 - 34451753
Alignment:
| Q |
20 |
gttcatggttgtaaatgttccacaatgcaagagagtggcggacatgatcatgtctgaagatcttcccctcatttgatgacttatcagtgaaattaggtga |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||| |
|
|
| T |
34451916 |
gttcatggttgtaaatgttccacaatgcaagagagtggcggacatgatcatgtctgaagatcttcccgtcacttgatgacttatcaatgaaattaggtga |
34451817 |
T |
 |
| Q |
120 |
ccgatatgtataaattggaatgtggagttgattacctaatatgatcatatttatattagaaata |
183 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34451816 |
ccgatatgtataaattggaatgtggggttgattacctaatatgatcatatttatattagaaata |
34451753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University