View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_high_10 (Length: 270)
Name: NF8853_high_10
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_high_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 14315798 - 14315545
Alignment:
| Q |
1 |
ccttcgaccaccccaacctcgaatccgcctccctggtatgccgctcatggtgcgaggcgctacgaccgttacgcgaggctatggtgatgctcatgtgggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14315798 |
ccttcgaccaccccaacctcgaatccgcctccctggtatgccgctcatggtgcgaggcgctacgaccgttacgcgaggctatggtgatgctcatgtgggg |
14315699 |
T |
|
| Q |
101 |
gaaacggttgaagcatggaaagcgtggagttcggaagaatacggagaaggcacttgagatgtttacgaaagctgcggcgaagggttcggctcttgctatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14315698 |
gaaacggttgaagcatggaaagcgtggagttcggaagaatacggagaaggcacttgagatgtttacgaaagctgcggcgaagggttcggctcttgctatg |
14315599 |
T |
|
| Q |
201 |
gtggatgctgggcttattcattgggagaaaggagagaaagataaagctcttgat |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14315598 |
gtggatgctgggcttattcattgggagaaaggagagaaagataaagctcttgat |
14315545 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University