View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_high_16 (Length: 239)
Name: NF8853_high_16
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_high_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 17 - 222
Target Start/End: Original strand, 7128063 - 7128268
Alignment:
| Q |
17 |
ttctctctctctgatcactttaatctacggaattgttgctaataaaagtctatctcttccgttggatcttgtttgcttcctatctgcctcacttttaaga |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128063 |
ttctctctctctgatcactttaatctacggaattgttgctaataaaagtctatctcttccgttggatcttgtttgcttcctatctgcctcacttttaaga |
7128162 |
T |
 |
| Q |
117 |
tagtctgttgttatccaagaaagagatggtctaaacatttacacacactagtcaagaaattcaatagtcttgatctgtcccttgcaataattctagagct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7128163 |
tagtctgttgttatccaagaaagagatggtctaaacatttacacacgctagtcaagaaattcaatagtcttgatctgtcccttgcaataattctagagct |
7128262 |
T |
 |
| Q |
217 |
tggtct |
222 |
Q |
| |
|
|||||| |
|
|
| T |
7128263 |
tggtct |
7128268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University