View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8853_high_19 (Length: 225)

Name: NF8853_high_19
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8853_high_19
NF8853_high_19
[»] chr5 (1 HSPs)
chr5 (18-210)||(2358054-2358246)


Alignment Details
Target: chr5 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 18 - 210
Target Start/End: Original strand, 2358054 - 2358246
Alignment:
18 gaggatgcaaaataaaattgcggggacaaaattaattaagtgtggtaaagtagatagatttatctcgtggaggggtaatactnnnnnnnnncaatgtgta 117  Q
    ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||         |||||||||    
2358054 gaggatgcaaaataaaattacggggacaaaattaattaagtgtggtaaagtagatagatttatctcgtggaggggtaatactaaaaaaaaacaatgtgta 2358153  T
118 ggtaaatacataattgaaatgtcctcgactactttgttcttttgatacttgtgtacgtacttgcaaaacgaattaatgctactctgtatatat 210  Q
    |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2358154 ggtaaatacataattgaaatgtcctcgactacttggttcttttgatacttgtgtacgtacttgcaaaacgaattaatgctactctgtatatat 2358246  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University