View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_high_9 (Length: 293)
Name: NF8853_high_9
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_high_9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 19 - 276
Target Start/End: Complemental strand, 14810811 - 14810554
Alignment:
| Q |
19 |
atcagatcgcccgagactggactatttgtggttagtggtcgaattgttggctattttcaggtggatcagtggtggtttctgatgtgggactgcggaaact |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||| |
|
|
| T |
14810811 |
atcagatcgcccgagactggactatttgtggttagtggtcgaattgttggctattttcaggtggatcagtggtggttttcgatgtgtgactgcggaaact |
14810712 |
T |
|
| Q |
119 |
gtatgaaagttcgtgatggactctactagtgtgatctttgtgggcgcaacacgtttgcagtgaagtctaagtaaggatgttttatcgttgttcttttgta |
218 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14810711 |
gcatgaaagttcgtgatggactctactagtgtgatctttgtgggcgcaacacgtttgcagtgaagtctaagtaaggatgttttatccttgttcttttgta |
14810612 |
T |
|
| Q |
219 |
ttctgattttgtgttatttgtatgtttacggtcgtgtctttattcgtaggtctgtgct |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
14810611 |
ttctgattttgtgttatttgtatgtttacggtcgtgtctttattcgtaggtctatgct |
14810554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University