View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8853_low_17 (Length: 270)

Name: NF8853_low_17
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8853_low_17
NF8853_low_17
[»] chr5 (1 HSPs)
chr5 (1-254)||(14315545-14315798)


Alignment Details
Target: chr5 (Bit Score: 254; Significance: 1e-141; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 14315798 - 14315545
Alignment:
1 ccttcgaccaccccaacctcgaatccgcctccctggtatgccgctcatggtgcgaggcgctacgaccgttacgcgaggctatggtgatgctcatgtgggg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14315798 ccttcgaccaccccaacctcgaatccgcctccctggtatgccgctcatggtgcgaggcgctacgaccgttacgcgaggctatggtgatgctcatgtgggg 14315699  T
101 gaaacggttgaagcatggaaagcgtggagttcggaagaatacggagaaggcacttgagatgtttacgaaagctgcggcgaagggttcggctcttgctatg 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14315698 gaaacggttgaagcatggaaagcgtggagttcggaagaatacggagaaggcacttgagatgtttacgaaagctgcggcgaagggttcggctcttgctatg 14315599  T
201 gtggatgctgggcttattcattgggagaaaggagagaaagataaagctcttgat 254  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14315598 gtggatgctgggcttattcattgggagaaaggagagaaagataaagctcttgat 14315545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University