View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_low_18 (Length: 267)
Name: NF8853_low_18
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 42010740 - 42010974
Alignment:
| Q |
1 |
cattaacattcgaaaagaaattaggactgttatcttgaggagagatatcacttgtcatgtactacaatcataaaataattcagttggaggataagaattt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42010740 |
cattaacattcgaaaagaaattaggactgttatcttgaggagagatatcacttgtcatgtcctacaatcataaagtaattcagttggaggataagaattt |
42010839 |
T |
 |
| Q |
101 |
cagtttggattaagtattaggaaaacaaaccaacaatgtcacggttgaaagtgttaccttttttgctacaaggacaacttcagtggctaactaactataa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
42010840 |
cagtttggattaagtattaggaaaacaaaccaacaatgtcacggttgaaagtgttaccttttttgctacaaggacaacttcagtcgccaactaactataa |
42010939 |
T |
 |
| Q |
201 |
gaggtgtatagatgttatttgagtatcatgatgat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
42010940 |
gaggtgtatagatgttatttgagtatcatgatgat |
42010974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University