View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_low_26 (Length: 237)
Name: NF8853_low_26
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 214
Target Start/End: Complemental strand, 22297301 - 22297088
Alignment:
| Q |
1 |
gatcactcattatcatcatatcttctacaaatatgaaaattgagtgttttccaatattgttaaagaatgagaattcatctcttttattcaattaacctga |
100 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
22297301 |
gatcactcgttatcatcatatcttctacaaatatgaaaattgagtgttttccaatattgttaaagaatgagaaatcatctcttttattcaattaacctga |
22297202 |
T |
|
| Q |
101 |
cacatagaatgacaaaagccaaaaaacatggatccatccacaaggtttgtttatttatatattacctttctcgtccccacttccaatctcacataacaaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22297201 |
cacatagaatgacaaaagccaaaaaacatggatccatccacaaggtttgtttatttatatattgcctttctcgtccccacttccaatctcacataacaaa |
22297102 |
T |
|
| Q |
201 |
gctcactcaaaaaa |
214 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
22297101 |
gctaactcaaaaaa |
22297088 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 30 - 68
Target Start/End: Complemental strand, 13024116 - 13024078
Alignment:
| Q |
30 |
aatatgaaaattgagtgttttccaatattgttaaagaat |
68 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13024116 |
aatatgaaaattgagtgttttccaatattgttcaagaat |
13024078 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 193
Target Start/End: Complemental strand, 13024047 - 13024004
Alignment:
| Q |
150 |
tttatttatatattacctttctcgtccccacttccaatctcaca |
193 |
Q |
| |
|
|||||||||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
13024047 |
tttatttatacattgcctttctcgtccccacttacaatctcaca |
13024004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University