View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_low_27 (Length: 234)
Name: NF8853_low_27
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 4e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 51 - 197
Target Start/End: Complemental strand, 3324816 - 3324670
Alignment:
| Q |
51 |
atgatctatatgatgtaagttttaccaagttggaaacaatatcacatgcttcacggatcttagaaatttcctggagatcgcttttgattggattaggaag |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3324816 |
atgatctatatgatgtaagttttaccaagttcgaaacaatatcacatgcatcacgaatcttagaaatttcctggagatcgcttttgattggattaggaag |
3324717 |
T |
|
| Q |
151 |
ttgtagcatggccatcaacactcttggcaagaacatatcacaggttc |
197 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3324716 |
ttgcagcatggccatcaacactcttggcaagaacatatcacaggttc |
3324670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 117 - 197
Target Start/End: Complemental strand, 3262380 - 3262300
Alignment:
| Q |
117 |
tttcctggagatcgcttttgattggattaggaagttgtagcatggccatcaacactcttggcaagaacatatcacaggttc |
197 |
Q |
| |
|
|||||| ||||||||| |||||| || |||||||||| | | | |||||| |||||||| |||| |||||||||||||| |
|
|
| T |
3262380 |
tttcctcgagatcgctattgattagaataggaagttgccacgtagtcatcaaaactcttggaaagagcatatcacaggttc |
3262300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 163 - 198
Target Start/End: Complemental strand, 12598838 - 12598803
Alignment:
| Q |
163 |
catcaacactcttggcaagaacatatcacaggttct |
198 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12598838 |
catcgacactcttggcaagaacatatcacaggttct |
12598803 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 51 - 99
Target Start/End: Original strand, 20812662 - 20812710
Alignment:
| Q |
51 |
atgatctatatgatgtaagttttaccaagttggaaacaatatcacatgc |
99 |
Q |
| |
|
|||||||||||||||| | |||||| |||||||||||| ||||||||| |
|
|
| T |
20812662 |
atgatctatatgatgtgaattttactgagttggaaacaacatcacatgc |
20812710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University