View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_low_28 (Length: 228)
Name: NF8853_low_28
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 3324648 - 3324428
Alignment:
| Q |
1 |
tctgatctttatgagaacatgggtcaattttccatttgcatttctttttctttaaagcaaaattttcaatagaagtgaaatgatgtttttcagataatta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
3324648 |
tctgatctttatgagaacatgggtcaattttccatttgcatttctttttctttaaagcaaaattttcaatagaagtgaaatgatgtttttaagataat-- |
3324551 |
T |
 |
| Q |
101 |
tagcattttctttttcaacattccatatttgttctgcatccatacggacttcttttgtta--nnnnnnnnncttctgaagtttgtatctatcatctttaa |
198 |
Q |
| |
|
|| || ||||||||||| ||| |||| ||||||||||||||||||||||||||||||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
3324550 |
taacactttctttttcagcataccatctttgttctgcatccatacggacttcttttgttattttttttcttcttctgatgtttgtatctattatctttaa |
3324451 |
T |
 |
| Q |
199 |
ttttctcataatactctctgctt |
221 |
Q |
| |
|
||||||||||||||||| ||||| |
|
|
| T |
3324450 |
ttttctcataatactctttgctt |
3324428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University