View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_low_29 (Length: 227)
Name: NF8853_low_29
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 218
Target Start/End: Complemental strand, 38666275 - 38666050
Alignment:
| Q |
1 |
cgataaagaggtttgttatgttgccataatgacgttgtgattatgattatgtgttcatttagtgta--------tactaaggttagatgaaaattgtggt |
92 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
38666275 |
cgataaagaggtttgttatgttgccataatgacgttgtgattatgattatgtgttcatttagtgtagaagtgtatactaaggttagatgaaaattgtggt |
38666176 |
T |
 |
| Q |
93 |
aggttagattagaccaatgttggatgtgcttatatctaataagagttaaggccaatttggataacctgttgaattaagcacatgtaacataagggtgcat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
38666175 |
aggttagattagaccaatgttggatgtgcttatagctaataagagttaaggccaatttggataaccggttgaattaagcatatgtaacataagggtgcat |
38666076 |
T |
 |
| Q |
193 |
tttattggcaaaacaacaagtattat |
218 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
38666075 |
tttattcgcaaaacaacaagtattat |
38666050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University