View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8853_low_9 (Length: 405)
Name: NF8853_low_9
Description: NF8853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8853_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 380; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 380; E-Value: 0
Query Start/End: Original strand, 18 - 401
Target Start/End: Complemental strand, 38666684 - 38666301
Alignment:
| Q |
18 |
tctccgaatcccaagccgtcggcgtcgtcgcttcttcccaagccaatttcatgcgcgtaatcgtccaatcacaaccttctggaaccttccaggacgcttc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666684 |
tctccgaatcccaagccgtcggcgtcgtcgcttcttcccaagccaatttcatgcgcgtaatcgtccaatcacaaccttctggaaccttccaggacgcttc |
38666585 |
T |
 |
| Q |
118 |
ttccagaggaggagctgaactgttatgcgttgtgagagcgttgctgaagaagataaagcgtagggttatggttggagataaggttttagtaggttctgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666584 |
ttccagaggaggagctgaactgttatgcgttgtgagagcgttgctgaagaagataaagcgtagggttatggttggagataaggttttagtaggttctgtt |
38666485 |
T |
 |
| Q |
218 |
gattgggttgatcgtagggctatgattgagaatgtgtttcagagaaattctgaaatgcttgatcctcctgtggctaatgtggatcatttgcttgttctgt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38666484 |
gattgggttgatcgtagggctatgattgagaatgtgtttcagagaaattctgaaatgcttgatcctcctgtggctaatgtggatcatttgcttgttctgt |
38666385 |
T |
 |
| Q |
318 |
tttcgcttgatcagcctaagcttgagccttttacgctaacacggtttttggttgaagctgagtctactgggattcttctcactc |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38666384 |
tttcgcttgatcagcctaagcttgagccttttacgctaacacggtttttggttgaagctgagtctactgggattcctctcactc |
38666301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University