View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8854_low_3 (Length: 240)
Name: NF8854_low_3
Description: NF8854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8854_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 17 - 228
Target Start/End: Complemental strand, 3146639 - 3146427
Alignment:
| Q |
17 |
acaaaacactgcacttgtcatcatcaaactcttccttcttaatcttcatcttcaccaacacaacacaaactttgacacgcatgcagcattcaattctaac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3146639 |
acaaaacactgcacttgtcatcatcaaactcttccttcttaatcttcatcttcaccaacacaacacaaactttgacacgcatgcagcattcaattctaac |
3146540 |
T |
|
| Q |
117 |
tttcaggttcatcttcttctttcttacaccacnnnnnnnnnnnnaatatagataaacttgttctg-tttgttgaaaattgtgttgtttaactcttcttta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
3146539 |
tttcaggttcatcttcttctttcttacaccactttttgttttttaatatagataaacttgttctgttttgttgaaaattgtgttgtttaactcttcttta |
3146440 |
T |
|
| Q |
216 |
ttgctcttgattc |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
3146439 |
ttgctcttgattc |
3146427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University